Login to display prices
Login to display prices
VDAC2-voltage-dependent anion channel 2 Gene View larger

VDAC2-voltage-dependent anion channel 2 Gene

PTXBC012883

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VDAC2-voltage-dependent anion channel 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VDAC2-voltage-dependent anion channel 2 Gene

Proteogenix catalog: PTXBC012883
Ncbi symbol: VDAC2
Product name: VDAC2-voltage-dependent anion channel 2 Gene
Size: 2ug
Accessions: BC012883
Gene id: 7417
Gene description: voltage-dependent anion channel 2
Synonyms: POR; voltage-dependent anion-selective channel protein 2; outer mitochondrial membrane protein porin 2; voltage dependent anion channel 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtattcctccatcatatgctgaccttggcaaagctgccagagatattttcaacaaaggatttggttttgggttggtgaaactggatgtgaaaacaaagtcttgcagtggcgtggaattttcaacgtccggttcatctaatacagacactggtaaagttactgggaccttggagaccaaatacaagtggtgtgagtatggtctgactttcacagaaaagtggaacactgataacactctgggaacagaaatcgcaattgaagaccagatttgtcaaggtttgaaactgacatttgatactaccttctcaccaaacacaggaaagaaaagtggtaaaatcaagtcttcttacaagagggagtgtataaaccttggttgtgatgttgactttgattttgctggacctgcaatccatggttcagctgtctttggttatgagggctggcttgctggctaccagatgacctttgacagtgccaaatcaaagctgacaaggaataactttgcagtgggctacaggactggggacttccagctacacactaatgtcaatgatgggacagaatttggaggatcaatttatcagaaagtttgtgaagatcttgacacttcagtaaaccttgcttggacatcaggtaccaactgcactcgttttggcattgcagctaaatatcagttggatcccactgcttccatttctgcaaaagtcaacaactctagcttaattggagtaggctatactcagactctgaggcctggtgtgaagcttacactctctgctctggtagatgggaagagcattaatgctggaggccacaaggttgggctcgccctggagttggaggcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: