VDAC2-voltage-dependent anion channel 2 Gene View larger

VDAC2-voltage-dependent anion channel 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VDAC2-voltage-dependent anion channel 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VDAC2-voltage-dependent anion channel 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012883
Product type: DNA & cDNA
Ncbi symbol: VDAC2
Origin species: Human
Product name: VDAC2-voltage-dependent anion channel 2 Gene
Size: 2ug
Accessions: BC012883
Gene id: 7417
Gene description: voltage-dependent anion channel 2
Synonyms: POR; voltage-dependent anion-selective channel protein 2; outer mitochondrial membrane protein porin 2; voltage dependent anion channel 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtattcctccatcatatgctgaccttggcaaagctgccagagatattttcaacaaaggatttggttttgggttggtgaaactggatgtgaaaacaaagtcttgcagtggcgtggaattttcaacgtccggttcatctaatacagacactggtaaagttactgggaccttggagaccaaatacaagtggtgtgagtatggtctgactttcacagaaaagtggaacactgataacactctgggaacagaaatcgcaattgaagaccagatttgtcaaggtttgaaactgacatttgatactaccttctcaccaaacacaggaaagaaaagtggtaaaatcaagtcttcttacaagagggagtgtataaaccttggttgtgatgttgactttgattttgctggacctgcaatccatggttcagctgtctttggttatgagggctggcttgctggctaccagatgacctttgacagtgccaaatcaaagctgacaaggaataactttgcagtgggctacaggactggggacttccagctacacactaatgtcaatgatgggacagaatttggaggatcaatttatcagaaagtttgtgaagatcttgacacttcagtaaaccttgcttggacatcaggtaccaactgcactcgttttggcattgcagctaaatatcagttggatcccactgcttccatttctgcaaaagtcaacaactctagcttaattggagtaggctatactcagactctgaggcctggtgtgaagcttacactctctgctctggtagatgggaagagcattaatgctggaggccacaaggttgggctcgccctggagttggaggcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - centrosomal protein 170kDa-like
- coiled-coil domain containing 24
- coiled-coil domain containing 82
- queuine tRNA-ribosyltransferase 1

Buy VDAC2-voltage-dependent anion channel 2 Gene now

Add to cart