CCDC24-coiled-coil domain containing 24 Gene View larger

CCDC24-coiled-coil domain containing 24 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC24-coiled-coil domain containing 24 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC24-coiled-coil domain containing 24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033868
Product type: DNA & cDNA
Ncbi symbol: CCDC24
Origin species: Human
Product name: CCDC24-coiled-coil domain containing 24 Gene
Size: 2ug
Accessions: BC033868
Gene id: 149473
Gene description: coiled-coil domain containing 24
Synonyms: coiled-coil domain-containing protein 24; coiled-coil domain containing 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctccggcactccccctcgctgtgggagctggtggaggagcacgttccgctccgggagcgacgcgaagtgaagaggattctgggggaggcggcggtggacctgagcctggagctgcgggcggaggtggcgatgttacgggcactgctccaagaggctcgatcctctcaagcccccagctcccgccccatctctgacccctcttctcttctggcaccaccgcctctcctaaaggacctcttgcgccaggagctccggcagttgctccagggtctccgccacaaagccatctgtgagggcagggaccaggcccaagcttgggtccagtatagccccagggtcctgcactttgccttggaggagcccaggtgtgatttgccagaacaggagatattccagatgagaggtggtgggcccagcagcggtcacagagatctcagcatcatcaaggaccaactgaacgtgtccaacattgaccaggtggccagacacctgaggggccttctggaggaggagtgtcacaccttggagagggagatcctcatcctgcagcgctgcctggaagaggagtatttgaggccttgccacccctctgaggcagccctggagcccaccctggcagagctaaaggaacagaagaaggccatggagcaggagctgcaggcatctgtggggccttcttgtgtctctcccaaccacaggcagcggcccttggggtcctccacacagggcctcagacccccgcttcccctctgcggggttgcacctctccagtgctgcctgcctgcacctcctctggagccctaccttcgacctcgaggccagtcggctacccaccgctggggacggcagcttcagtgcagccccagggaagggccagcttccacacccatgtccagtgcagcaccccaagccccagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 82
- queuine tRNA-ribosyltransferase 1
- tyrosylprotein sulfotransferase 2
- tyrosylprotein sulfotransferase 2

Buy CCDC24-coiled-coil domain containing 24 Gene now

Add to cart