Login to display prices
Login to display prices
TPST2-tyrosylprotein sulfotransferase 2 Gene View larger

TPST2-tyrosylprotein sulfotransferase 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPST2-tyrosylprotein sulfotransferase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TPST2-tyrosylprotein sulfotransferase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017509
Product type: DNA & cDNA
Ncbi symbol: TPST2
Origin species: Human
Product name: TPST2-tyrosylprotein sulfotransferase 2 Gene
Size: 2ug
Accessions: BC017509
Gene id: 8459
Gene description: tyrosylprotein sulfotransferase 2
Synonyms: TANGO13B; protein-tyrosine sulfotransferase 2; TPST-2; transport and golgi organization 13 homolog B; tyrosylprotein phosphotransferase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgcctgtcggtgcggagggtgctgctggcagccggctgcgccctggtcctggtgctggcggttcagctgggacagcaggtgctagagtgccgggcggtgctggcgggcctgcggagcccccggggggccatgcggcctgagcaggaggagctggtgatggtgggcaccaaccacgtggaataccgctatggcaaggccatgccgctcatcttcgtgggtggcgtgcctcgcagtggcaccacgttgatgcgcgccatgctggacgcccaccctgaggtgcgctgcggcgaggagacccgcatcatcccgcgcgtgctggccatgcgccaggcctggtccaagtctggccgtgagaagctgcggctggatgaggcgggggtgacggatgaggtgctggacgccgccatgcaggccttcatcctggaggtgattgccaagcacggagagccggcccgcgtgctctgcaacaaggacccatttacgctcaagtcctcggtctacctgtcgcgcctgttccccaactccaagttcctgctgatggtgcgggacggccgggcctccgtgcactccatgatcacgcgcaaagtcaccattgcgggctttgacctcagcagctaccgtgactgcctcaccaagtggaacaaggccatcgaggtgatgtacgcccagtgcatggaggtaggcaaggagaagtgcttgcctgtgtactacgagcagctggtgctgcaccccaggcgctcactcaagctcatcctcgacttcctcggcatcgcctggagcgacgctgtcctccaccatgaagacctcattggcaagcccggtggtgtctccctgtccaagatcgagcggtccacggaccaggtcatcaagcctgttaacctggaagcgctctccaagtggactggccacatccctggggatgtggtgcgggacatggcccagatcgcccccatgctggctcagctcggctatgacccttatgcaaacccccccaactatggcaaccctgaccccttcgtcatcaacaacacacagcgggtcttgaaaggggactataaaacaccagccaatctgaaaggatattttcaggtgaaccagaacagcacctcctcccacttaggaagctcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 51
- LAG1 homolog, ceramide synthase 2
- LAG1 homolog, ceramide synthase 2
- endothelial cell adhesion molecule