ESAM-endothelial cell adhesion molecule Gene View larger

ESAM-endothelial cell adhesion molecule Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ESAM-endothelial cell adhesion molecule Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ESAM-endothelial cell adhesion molecule Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016868
Product type: DNA & cDNA
Ncbi symbol: ESAM
Origin species: Human
Product name: ESAM-endothelial cell adhesion molecule Gene
Size: 2ug
Accessions: BC016868
Gene id: 90952
Gene description: endothelial cell adhesion molecule
Synonyms: W117m; endothelial cell-selective adhesion molecule; 2310008D05Rik; HUEL (C4orf1)-interacting protein; LP4791 protein; endothelial cell adhesion molecule
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatttccctcccggggcccctggtgaccaacttgctgcggtttttgttcctggggctgagtgccctcgcgcccccctcgcgggcccagctgcaactgcacttgcccgccaaccggttgcaggcggtggagggaggggaagtggtgcttccagcgtggtacaccttgcacggggaggtgtcttcatcccagccatgggaggtgccctttgtgatgtggttcttcaaacagaaagaaaaggaggatcaggtgttgtcctacatcaatggggtcacaacaagcaaacctggagtatccttggtctactccatgccctcccggaacctgtccctgcggctggagggtctccaggagaaagactctggcccctacagctgctccgtgaatgtgcaagacaaacaaggcaaatctaggggccacagcatcaaaaccttagaactcaatgtactggttcctccagctcctccatcctgccgtctccagggtgtgccccatgtgggggcaaacgtgaccctgagctgccagtctccaaggagtaagcccgctgtccaataccagtgggatcggcagcttccatccttccagactttctttgcaccagcattagatgtcatccgtgggtctttaagcctcaccaacctttcgtcttccatggctggagtctatgtctgcaaggcccacaatgaggtgggcactgcccaatgtaatgtgacgctggaagtgagcacagggcctggagctgcagtggttgctggagctgttgtgggtaccctggttggactggggttgctggctgggctggtcctcttgtaccaccgccggggcaaggccctggaggagccagccaatgatatcaaggaggatgccattgctccccggaccctgccctggcccaagagctcagacacaatctccaagaatgggaccctttcctctgtcacctccgcacgagccctccggccaccccatggccctcccaggcctggtgcattgacccccacgcccagtctctccagccaggccctgccctcaccaagactgcccacgacagatggggcccaccctcaaccaatatcccccatccctggtggggtttcttcctctggcttgagccgcatgggtgctgtgcctgtgatggtgcctgcccagagtcaagctggctctctggtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GTP binding protein 6 (putative)
- isovaleryl Coenzyme A dehydrogenase
- TBC1 domain family, member 22A
- coiled-coil domain containing 47

Buy ESAM-endothelial cell adhesion molecule Gene now

Add to cart