IVD-isovaleryl Coenzyme A dehydrogenase Gene View larger

IVD-isovaleryl Coenzyme A dehydrogenase Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IVD-isovaleryl Coenzyme A dehydrogenase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IVD-isovaleryl Coenzyme A dehydrogenase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017202
Product type: DNA & cDNA
Ncbi symbol: IVD
Origin species: Human
Product name: IVD-isovaleryl Coenzyme A dehydrogenase Gene
Size: 2ug
Accessions: BC017202
Gene id: 3712
Gene description: isovaleryl Coenzyme A dehydrogenase
Synonyms: ACAD2; isovaleryl-CoA dehydrogenase, mitochondrial; isovaleryl Coenzyme A dehydrogenase; isovaleryl-CoA dehydrogenase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcaggagcacctggcccccaaggcccaggagatcgatcgcagcaatgagttcaagaacctgcgagaattttggaagcagctggggaacctgggcgtattgggcatcacagcccctgttcagtatggcggctccggcctgggctacctggagcatgtgctggtgatggaggagatatcccgagcttccggagcagtggggctcagttacggtgcccactccaacctctgcatcaaccagcttgtacgcaatgggaatgaggcccagaaagagaagtatctcccgaagctgatcagtggtgagtacatcggagccctggccatgagtgagcccaatgcaggctctgatgttgtctctatgaagctcaaagcggaaaagaaaggaaatcactacatcctgaatggcaacaagttctggatcactaatggccctgatgctgacgtcctgattgtctatgccaagacagatctggctgctgtgccagcttctcggggcatcacagccttcattgtggagaagggtatgcctggctttagcacctctaagaagctggacaagctggggatgaggggctctaacacctgtgagctaatctttgaagactgcaagattcctgctgccaacatcctgggccatgagaataagggtgtctacgtgctgatgagtgggctggacctggagcggctggtgctggccggggggcctcttgggctcatgcaagcggtcctggaccacaccattccctacctgcacgtgagggaagcctttggccagaagatcggccacttccagttgatgcaggggaagatggctgacatgtacacccgcctcatggcgtgtcggcagtatgtctacaatgtcgccaaggcctgcgatgagggccattgcactgctaaggactgtgcaggtgtgattctttactcagctgagtgtgccacacaggtagccctggacggcattcagtgttttggtggcaatggctacatcaatgactttcccatgggccgctttcttcgagatgccaagctgtatgagataggggctgggaccagcgaggtgaggcggctggtcatcggcagagccttcaatgcagactttcactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TBC1 domain family, member 22A
- coiled-coil domain containing 47
- signal recognition particle 54kDa
- signal peptide peptidase-like 2A

Buy IVD-isovaleryl Coenzyme A dehydrogenase Gene now

Add to cart