TBC1D22A-TBC1 domain family, member 22A Gene View larger

TBC1D22A-TBC1 domain family, member 22A Gene

PTXBC002743

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TBC1D22A-TBC1 domain family, member 22A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TBC1D22A-TBC1 domain family, member 22A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002743
Product type: DNA & cDNA
Ncbi symbol: TBC1D22A
Origin species: Human
Product name: TBC1D22A-TBC1 domain family, member 22A Gene
Size: 2ug
Accessions: BC002743
Gene id: 25771
Gene description: TBC1 domain family, member 22A
Synonyms: C22orf4; HSC79E021; TBC1 domain family member 22A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagcgacggggccaggaagcaattctggaagcgcagcaacagcaagctcccgggcagtttgctcaggtccacggccaagatgccgaccacaccagtgaaggccaagagggtcagcaccttccaggagtttgagagcaataccagcgatgcctgggacgctggggaggacgacgatgagctcctggccatggcggcggagagcctgaactccgaggtggtcatggagacggccaaccgtgtgctgcgtaaccacagccagcggcaggggcggcccacgctgcaggaggggccagggcttcagcagaagcccaggcccgaggcagagccgccctcaccccccagcggcgacctccggctggtgaagtcggtcagtgagagccacacgtcctgtcctgcagaggaattacggaggttgagctggtccggaatccctaagccagtgcgtccaatgacgtggaagctcctctcaggttaccttcccgccaatgtagaccggagaccagccactctccagagaaaacaaaaagaatattttgcatttattgagcactattacgattctaggaacgacgaagttcaccaggacacatacaggcagatccacatagacatccctcgcatgagccctgaagcgttgatcctgcagcccaaggtgacggagatttttgaaaggatcttgttcatatgggcgatccgccacccagccagtggatacgttcagggtataaatgatctcgtcactcctttctttgtggtcttcatttgtgaatacatagaggcagaggaggtggacacggtggacgtctccggcgtgcccgcagaggtgctgtgcaacatcgaggccgacacctactggtgcatgagcaagctgctggatggcattcaggacaactacacctttgcccaacctgggattcaaatgaaagtgaaaatgttagaagaactcgtgagccggattgatgagcaagtgcaccggcacctggaccaacacgaagtgagatacctgcagtttgccttccgctggatgaacaacctgctgatgagggaggtgcccctgcgttgtaccatccgcctgtgggacacctaccagtctgaaccggacggcttttctcatttccacttgtacgtgtgcgctgcttttctcgtgagatggaggaaggaaatactagaagaaaaagattttcaagagctgctgctcttcctccagaacctgcccacagcccactgggatgatgaggacatcagcctgttgctggccgaggcctaccgcctcaagtttgcttttgccgacgcccccaatcactacaagaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 47
- signal recognition particle 54kDa
- signal peptide peptidase-like 2A
- acyloxyacyl hydrolase (neutrophil)

Buy TBC1D22A-TBC1 domain family, member 22A Gene now

Add to cart