LASS2-LAG1 homolog, ceramide synthase 2 Gene View larger

LASS2-LAG1 homolog, ceramide synthase 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LASS2-LAG1 homolog, ceramide synthase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LASS2-LAG1 homolog, ceramide synthase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001357
Product type: DNA & cDNA
Ncbi symbol: LASS2
Origin species: Human
Product name: LASS2-LAG1 homolog, ceramide synthase 2 Gene
Size: 2ug
Accessions: BC001357
Gene id: 29956
Gene description: LAG1 homolog, ceramide synthase 2
Synonyms: LASS2; SP260; TMSG1; ceramide synthase 2; LAG1 homolog, ceramide synthase 2; LAG1 longevity assurance 2; longevity assurance (LAG1, S. cerevisiae) homolog 2; tumor metastasis-suppressor gene 1 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctccagaccttgtatgattacttctggtgggaacgtctgtggctgcctgtgaacttgacctgggccgatctagaagaccgagatggacgtgtctacgccaaagcctcagatctctatatcacgctgcccctggccttgctcttcctcatcgttcgatacttctttgagctgtacgtggctacaccactggctgccctcttgaacataaaggagaaaactcggctgcgggcacctcccaacgccaccttggaacatttctacctgaccagtggcaagcagcccaagcaggtggaagtagagcttttgtcccggcagagcgggctctctggccgccaggtagagcgttggttccgtcgccgccgcaaccaggaccggcccagtctcctcaagaagttccgagaagccagctggagattcacattttacctgattgccttcattgccggcatggccgtcattgtggataaaccctggttctatgacatgaagaaagtttgggagggatatcccatacagagcactatcccttcccagtattggtactacatgattgaactttccttctactggtccctgctcttcagcattgcctctgatgtcaagcgaaaggatttcaaggaacagatcatccaccatgtggccaccatcattctcatcagcttttcctggtttgccaattacatccgagctgggactctaatcatggctctgcatgactcttccgattacctgctggagtcagccaagatgtttaactacgcgggatggaagaacacctgcaacaacatcttcatcgtcttcgccattgtttttatcatcacccgactggtcatcctgcccttctggatcctgcattgcaccctggtgtacccactggagctctatcctgccttctttggctattacttcttcaattccatgatgggagttctacagctgctgcatatcttctgggcctacctcattttgcgcatggcccacaagttcataactggaaagctggtagaagatgaacgcagtgaccgggaagaaacagagagctcagagggggaggaggctgcagctgggggaggagcaaagagccggcccctagccaatggccaccccatcctcaataacaaccatcgtaagaatgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - endothelial cell adhesion molecule
- GTP binding protein 6 (putative)
- isovaleryl Coenzyme A dehydrogenase
- TBC1 domain family, member 22A

Buy LASS2-LAG1 homolog, ceramide synthase 2 Gene now

Add to cart