Login to display prices
Login to display prices
QTRT1-queuine tRNA-ribosyltransferase 1 Gene View larger

QTRT1-queuine tRNA-ribosyltransferase 1 Gene

PTXBC015350

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of QTRT1-queuine tRNA-ribosyltransferase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about QTRT1-queuine tRNA-ribosyltransferase 1 Gene

Proteogenix catalog: PTXBC015350
Ncbi symbol: QTRT1
Product name: QTRT1-queuine tRNA-ribosyltransferase 1 Gene
Size: 2ug
Accessions: BC015350
Gene id: 81890
Gene description: queuine tRNA-ribosyltransferase 1
Synonyms: FP3235; TGUT; queuine tRNA-ribosyltransferase catalytic subunit 1; TGT, 43-KD subunit; TGT, catalytic subunit; guanine insertion enzyme; queuine tRNA-ribosyltransferase 1; tRNA-guanine transglycosylase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagtgggcacgcaggccaccatgaagggcatcacgaccgaacagctggacgctctgggttgccgcatctgcctgggcaatacctaccatctgggtctaaggccgggacccgagctgatccagaaagccaacggtctccacggcttcatgaattggcctcataatctgctaacggacagcggcggtttccagatggtgtcgctggtgtctctgtccgaggtgacggaggagggcgtccgcttccgctccccctacgacggcaatgagaccctgctgagcccggagaaatccgtgcagatccagaatgcgctgggctcggacatcatcatgcagctggacgacgtggttagcagtactgtgactgggccacgtgtggaggaggccatgtacaggtcaatccgctggctggaccggtgcattgcagcccatcagcggccggacaagcagaacctcttcgccattatccagggtgggctggacgcagatctccgggccacctgccttgaagagatgaccaagcgagacgtgcctggcttcgccatcgggggcctgagcgggggtgagagcaagtcgcagttctggcggatggtggcgctgagcacctctcggctgccgaaggacaagccccgatatctgatgggggttggctatgccactgatctggtagtctgcgtggctcttggatgtgacatgttcgactgcgtcttccccacacggacagcgcgctttggctctgccctggtgcccactgggaacctgcagttgaggaagaaggtgtttgagaaggacttcggccccatagacccggagtgcacctgccccacgtgccaaaagcacagccgcgccttcctgcacgcactgctgcacagtgacaacacggccgcgctgcaccacctcacggtccacaacatcgcctaccagctgcagctcatgagcgccgtccgcaccagcatcgtggagaagcgcttcccggacttcgtgcgggacttcatgggcgccatgtacggggatcccaccctctgtcccacctgggccactgacgctctggcctctgtgggaatcacactgggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: