CCDC82-coiled-coil domain containing 82 Gene View larger

CCDC82-coiled-coil domain containing 82 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC82-coiled-coil domain containing 82 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC82-coiled-coil domain containing 82 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018663
Product type: DNA & cDNA
Ncbi symbol: CCDC82
Origin species: Human
Product name: CCDC82-coiled-coil domain containing 82 Gene
Size: 2ug
Accessions: BC018663
Gene id: 79780
Gene description: coiled-coil domain containing 82
Synonyms: HSPC048; coiled-coil domain-containing protein 82; coiled-coil domain containing 82
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatacatgttagaagacatgaaacaaggagaaattctaagagtcacgtgcctgagcagaaatctcgagttgattggaggcgaactaaaagaagtagtatctcacaattacttgatagtgatgaagagcttgatagtgaagaatttgatagtgatgaagagcttgatagtgatgaaagttttgaaaatgatgaagagcttgatagtaacaagggacctgattgtaataaaacaccaggaagtgaaagagagctcaacttaagtaaaattcaaagtgaaggaaatgacagtaagtgtctcattaactctggcaacggttcaacatatgaagaagaaacgaacaaaatcaaacataggaatattgacttacaagatcaggaaaaacatttaagtcaagaggataatgatctcaacaaacaaactggacaaataatagaggatgatgaggaaaaacatttaagtcaagaggataatgatctcaacaaacaaactggacaaataatagaggatgatttagaagaagaagacatcaagcgaggaaaaagaaaaaggctatcctctgtgatgtgtgacagtgatgagagtgatgacagcgatatcctagttagaaaagtaggtgttaaacgtccccgtagagtggttgaagatgaaggttcttcagtggaaatggagcaaaagactcctgaaaaaacattagctgcacaaaagcgagaaaaacttcagaagctcaaagaactctcaaaacaaagatctcgtcagagacgcagtagtggtagagattttgaggactctgaaaaggaatcttgcccaagcagtgatgaagttgatgaggaggaagaagaggataattatgaatctgatgaagatggagatgattatattatcgatgactttgtagtgcaagatgaggagggtgatgaagagaataaaaaccaacaaggagaaaaattgactacatcacaactgaaattagtaaaacagaattctctttgtaagttcaatattaagaaaatgtttcatgaattgttctcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - queuine tRNA-ribosyltransferase 1
- tyrosylprotein sulfotransferase 2
- tyrosylprotein sulfotransferase 2
- coiled-coil domain containing 51

Buy CCDC82-coiled-coil domain containing 82 Gene now

Add to cart