CEP170L-centrosomal protein 170kDa-like Gene View larger

CEP170L-centrosomal protein 170kDa-like Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CEP170L-centrosomal protein 170kDa-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CEP170L-centrosomal protein 170kDa-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014590
Product type: DNA & cDNA
Ncbi symbol: CEP170L
Origin species: Human
Product name: CEP170L-centrosomal protein 170kDa-like Gene
Size: 2ug
Accessions: BC014590
Gene id: 645455
Gene description: centrosomal protein 170kDa-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctactagttcttcattcaaacaccggattaaagagcaggaagactacatccgagattggactgctcatcgagaagagatagccaggatcagccaagatcttgctctcattgctcgggagatcaacgatgtagcaggagagatagattcagtgacttcatcaggcactgcccctagtaccacattggttgatcgtgtttttgatgaaagcctcaacttccaaaagattcctccattagttcattccaaaacaccagaaggaaacaacggtcgatctggtgatccaagacctcaagcagcagagcctcccgatcacttaacaattacaaggcggagaacctggagcagggatgaagtcatgggagataatctgctgctgtcatccgtctttcagttctctaagaagataagacaatctatagataagacagctggaaagatcagaatattatttaaagacaaagatcggaattgggatgacatagaaagcaaattaagagccgaaagtgaagtccctattgtgaaaacctcgagcatggagatttcttctatcttacaggaactgaaaagagtagaaaagcagctacaagcaatcaatgctatgattgatcctgatggaactttggaggctctgaacaacatgggatttcccagtgctatgttgccatctccaccgaaacagaagtccagccctgtgaataaccaccacagcccgggtcagacaccaacacttggccaaccagaagctagggctcttcatcctgctgctgtttcagccgcagctgaatttgagaatgctgaatctgaggctgatttcagtatacatttcaatagagtcaaccctgatggggaagaggaagatgttacagtacataaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 24
- coiled-coil domain containing 82
- queuine tRNA-ribosyltransferase 1
- tyrosylprotein sulfotransferase 2

Buy CEP170L-centrosomal protein 170kDa-like Gene now

Add to cart