Login to display prices
Login to display prices
CCDC34-coiled-coil domain containing 34 Gene View larger

CCDC34-coiled-coil domain containing 34 Gene

PTXBC008496

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC34-coiled-coil domain containing 34 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC34-coiled-coil domain containing 34 Gene

Proteogenix catalog: PTXBC008496
Ncbi symbol: CCDC34
Product name: CCDC34-coiled-coil domain containing 34 Gene
Size: 2ug
Accessions: BC008496
Gene id: 91057
Gene description: coiled-coil domain containing 34
Synonyms: L15; NY-REN-41; RAMA3; coiled-coil domain-containing protein 34; NY-REN-41 antigen; renal carcinoma antigen NY-REN-41; coiled-coil domain containing 34
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggcggcggggcgctgggggcctacttttccctcttcctacgccggtttctctgctgactgcagacccaggtctcggccctcctcggactcctgctcagtccctatgacgggcgcacgtgggcaggggctggaggtggtgcgctcgccgtcgccgccgctgccgctgagctgcagcaattccaccaggtcgctgttgtctccccttggccaccagagcttccagtttgacgaggacgacggtgacggggaggatgaggaagacgtggatgatgaggaagacgtggatgaagatgcccatgattcagaggccaaagtggcgagcctgagaggaatggagttacaggggtgcgccagcactcaggttgaatcagaaaataaccaagaagaacagaaacaggtgcgcttaccagaaagccgcctgacaccatgggaggtgtggtttattggcaaagaaaaagaagaacgtgaccggctgcaactgaaagctctagaggaattaaatcaacaactagaaaaaagaaaagaaatggaagaacgtgaaaaaagaaagataattgctgaagaaaagcacaaggaatgggttcagaaaaagaatgagcaagtaaggaggggaaaatggatacacacattgacatctcttttgcaaaatatttcttcctattatacttcattacctaggttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: