Login to display prices
Login to display prices
TIMP4-TIMP metallopeptidase inhibitor 4 Gene View larger

TIMP4-TIMP metallopeptidase inhibitor 4 Gene

PTXBC010553

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIMP4-TIMP metallopeptidase inhibitor 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TIMP4-TIMP metallopeptidase inhibitor 4 Gene

Proteogenix catalog: PTXBC010553
Ncbi symbol: TIMP4
Product name: TIMP4-TIMP metallopeptidase inhibitor 4 Gene
Size: 2ug
Accessions: BC010553
Gene id: 7079
Gene description: TIMP metallopeptidase inhibitor 4
Synonyms: metalloproteinase inhibitor 4; TIMP-4; tissue inhibitor of metalloproteinase 4; tissue inhibitor of metalloproteinases 4; TIMP metallopeptidase inhibitor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgggagccctcggcccgcgccaagctgggtgctgttgctgcggctgctggcgttgctgcggcccccggggctgggtgaggcatgcagctgcgccccggcgcaccctcagcagcacatctgccactcggcacttgtgattcgggccaaaatctccagtgagaaggtagttccggccagtgcagaccctgctgacactgaaaaaatgctccggtatgaaatcaaacagataaagatgttcaaagggtttgagaaagtcaaggatgttcagtatatctatacgccttttgactcttccctctgtggtgtgaaactagaagccaacagccagaagcagtatctcttgactggtcaggtcctcagtgatggaaaagtcttcatccatctgtgcaactacatcgagccctgggaggacctgtccttggtgcagagggaaagtctgaatcatcactaccatctgaactgtggctgccaaatcaccacctgctacacagtaccctgtaccatctcggcccctaacgagtgcctctggacagactggctgttggaacgaaagctctatggttaccaggctcagcattatgtctgtatgaagcatgttgacggcacctgcagctggtaccggggccacctgcctctcaggaaggagtttgttgacatcgttcagccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice