PTXBC010553
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC010553 |
Product type: | DNA & cDNA |
Ncbi symbol: | TIMP4 |
Origin species: | Human |
Product name: | TIMP4-TIMP metallopeptidase inhibitor 4 Gene |
Size: | 2ug |
Accessions: | BC010553 |
Gene id: | 7079 |
Gene description: | TIMP metallopeptidase inhibitor 4 |
Synonyms: | metalloproteinase inhibitor 4; TIMP-4; tissue inhibitor of metalloproteinase 4; tissue inhibitor of metalloproteinases 4; TIMP metallopeptidase inhibitor 4 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcctgggagccctcggcccgcgccaagctgggtgctgttgctgcggctgctggcgttgctgcggcccccggggctgggtgaggcatgcagctgcgccccggcgcaccctcagcagcacatctgccactcggcacttgtgattcgggccaaaatctccagtgagaaggtagttccggccagtgcagaccctgctgacactgaaaaaatgctccggtatgaaatcaaacagataaagatgttcaaagggtttgagaaagtcaaggatgttcagtatatctatacgccttttgactcttccctctgtggtgtgaaactagaagccaacagccagaagcagtatctcttgactggtcaggtcctcagtgatggaaaagtcttcatccatctgtgcaactacatcgagccctgggaggacctgtccttggtgcagagggaaagtctgaatcatcactaccatctgaactgtggctgccaaatcaccacctgctacacagtaccctgtaccatctcggcccctaacgagtgcctctggacagactggctgttggaacgaaagctctatggttaccaggctcagcattatgtctgtatgaagcatgttgacggcacctgcagctggtaccggggccacctgcctctcaggaaggagtttgttgacatcgttcagccctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - coiled-coil domain containing 34 - RAB7A, member RAS oncogene family - DNA-damage-inducible transcript 4 - tissue factor pathway inhibitor 2 |