TIMP3-TIMP metallopeptidase inhibitor 3 Gene View larger

TIMP3-TIMP metallopeptidase inhibitor 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIMP3-TIMP metallopeptidase inhibitor 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TIMP3-TIMP metallopeptidase inhibitor 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014277
Product type: DNA & cDNA
Ncbi symbol: TIMP3
Origin species: Human
Product name: TIMP3-TIMP metallopeptidase inhibitor 3 Gene
Size: 2ug
Accessions: BC014277
Gene id: 7078
Gene description: TIMP metallopeptidase inhibitor 3
Synonyms: HSMRK222; K222; K222TA2; SFD; metalloproteinase inhibitor 3; MIG-5 protein; protein MIG-5; tissue inhibitor of metalloproteinases 3; TIMP metallopeptidase inhibitor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccccttggctcgggctcatcgtgctcctgggcagctggagcctgggggactggggcgccgaggcgtgcacatgctcgcccagccacccccaggacgccttctgcaactccgacatcgtgatccgggccaaggtggtggggaagaagctggtaaaggaggggcccttcggcacgctggtctacaccatcaagcagatgaagatgtaccgaggcttcaccaagatgccccatgtgcagtacatccatacggaagcttccgagagtctctgtggccttaagctggaggtcaacaagtaccagtacctgctgacaggtcgcgtctatgatggcaagatgtacacggggctgtgcaacttcgtggagaggtgggaccagctcaccctctcccagcgcaaggggctgaactatcggtatcacctgggttgtaactgcaagatcaagtcctgctactacctgccttgctttgtgacttccaagaacgagtgtctctggaccgacatgctctccaatttcggttaccctggctaccagtccaaacactacgcctgcatccggcagaagggcggctactgcagctggtaccgaggatgggcccccccggataaaagcatcatcaatgccacagacccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB5A, member RAS oncogene family
- RAB3D, member RAS oncogene family
- TIMP metallopeptidase inhibitor 4
- coiled-coil domain containing 34

Buy TIMP3-TIMP metallopeptidase inhibitor 3 Gene now

Add to cart