Login to display prices
Login to display prices
TIMP3-TIMP metallopeptidase inhibitor 3 Gene View larger

TIMP3-TIMP metallopeptidase inhibitor 3 Gene

PTXBC014277

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIMP3-TIMP metallopeptidase inhibitor 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TIMP3-TIMP metallopeptidase inhibitor 3 Gene

Proteogenix catalog: PTXBC014277
Ncbi symbol: TIMP3
Product name: TIMP3-TIMP metallopeptidase inhibitor 3 Gene
Size: 2ug
Accessions: BC014277
Gene id: 7078
Gene description: TIMP metallopeptidase inhibitor 3
Synonyms: HSMRK222; K222; K222TA2; SFD; metalloproteinase inhibitor 3; MIG-5 protein; protein MIG-5; tissue inhibitor of metalloproteinases 3; TIMP metallopeptidase inhibitor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccccttggctcgggctcatcgtgctcctgggcagctggagcctgggggactggggcgccgaggcgtgcacatgctcgcccagccacccccaggacgccttctgcaactccgacatcgtgatccgggccaaggtggtggggaagaagctggtaaaggaggggcccttcggcacgctggtctacaccatcaagcagatgaagatgtaccgaggcttcaccaagatgccccatgtgcagtacatccatacggaagcttccgagagtctctgtggccttaagctggaggtcaacaagtaccagtacctgctgacaggtcgcgtctatgatggcaagatgtacacggggctgtgcaacttcgtggagaggtgggaccagctcaccctctcccagcgcaaggggctgaactatcggtatcacctgggttgtaactgcaagatcaagtcctgctactacctgccttgctttgtgacttccaagaacgagtgtctctggaccgacatgctctccaatttcggttaccctggctaccagtccaaacactacgcctgcatccggcagaagggcggctactgcagctggtaccgaggatgggcccccccggataaaagcatcatcaatgccacagacccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: