No products
Prices are tax excluded
PTXBC066306
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066306 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUMO1 |
| Origin species: | Human |
| Product name: | SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC066306 |
| Gene id: | 7341 |
| Gene description: | SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) |
| Synonyms: | DAP1; GMP1; OFC10; PIC1; SENP2; SMT3; SMT3C; SMT3H3; UBL1; small ubiquitin-related modifier 1; GAP modifying protein 1; SMT3 homolog 3; SMT3 suppressor of mif two 3 homolog 1; sentrin; ubiquitin-homology domain protein PIC1; ubiquitin-like protein SMT3C; ubiquitin-like protein UBL1; small ubiquitin-like modifier 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgaccaggaggcaaaaccttcaactgaggacttgggggataagaaggaaggtgaatatattaaactcaaagtcattggacaggatagcagtgagattcacttcaaagtgaaaatgacaacacatctcaagaaactcaaagaatcatactgtcaaagacagggtgttccaatgaattcactcaggtttctctttgagggtcagagaattgctgataataatactccaaaagaactgggaatggaggaagaagatgtgattgaagtttatcaggaacaaacggggggtcattcaacagtttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ArfGAP with SH3 domain, ankyrin repeat and PH domain 3 - ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 - ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) - proteasome (prosome, macropain) subunit, alpha type, 2 |