Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBE2K-ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene
PTXBC022804
New product
Data sheet of UBE2K-ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2K-ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022804 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2K |
| Origin species: | Human |
| Product name: | UBE2K-ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene |
| Size: | 2ug |
| Accessions: | BC022804 |
| Gene id: | 3093 |
| Gene description: | ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) |
| Synonyms: | E2-25K; HIP2; HYPG; LIG; UBC1; ubiquitin-conjugating enzyme E2 K; E2 ubiquitin-conjugating enzyme K; E2(25K); HIP-2; huntingtin-interacting protein 2; ubiquitin carrier protein; ubiquitin conjugating enzyme E2K; ubiquitin-conjugating enzyme E2(25K); ubiquitin-conjugating enzyme E2-25 KDA; ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast); ubiquitin-protein ligase; ubiquitin conjugating enzyme E2 K |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaacatcgcggtgcagcgaatcaagcgggagttcaaggaggtgctgaagagcgaggagacgagcaaaaatcaaattaaagtagatcttgtagatgagaattttacagaattaagaggagaaatagcaggacctccagacacaccatatgaaggaggaagataccaactagagataaaaataccagaaacatacccatttaatccccctaaggtccggtttatcactaaaatatggcatcctaatattagttccgtcacaggggctatttgtttggatatcctgaaagatcaatgggcagctgcaatgactctccgcacggtattattgtcattgcaagcactattggcagctgcagagccagatgatccacaggatgctgtagtagcaaatcagtacaaacaaaatcccgaaatgttcaaacagacagctcgactttgggcacatgtgtatgctggagcaccagtttctagtccagaatacaccaaaaaaatagaaaacctatgtgctatgggctttgataggaatgcagtaatagtggccttgtcttcaaaatcatgggatgtagagactgcaacagaattgcttctgagtaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, alpha type, 2 - tRNA splicing endonuclease 54 homolog (S. cerevisiae) - vacuolar protein sorting 37 homolog D (S. cerevisiae) - hepatocyte growth factor (hepapoietin A; scatter factor) |