Login to display prices
Login to display prices
UBE2K-ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene View larger

UBE2K-ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene

PTXBC022804

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2K-ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2K-ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene

Proteogenix catalog: PTXBC022804
Ncbi symbol: UBE2K
Product name: UBE2K-ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) Gene
Size: 2ug
Accessions: BC022804
Gene id: 3093
Gene description: ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)
Synonyms: E2-25K; HIP2; HYPG; LIG; UBC1; ubiquitin-conjugating enzyme E2 K; E2 ubiquitin-conjugating enzyme K; E2(25K); HIP-2; huntingtin-interacting protein 2; ubiquitin carrier protein; ubiquitin conjugating enzyme E2K; ubiquitin-conjugating enzyme E2(25K); ubiquitin-conjugating enzyme E2-25 KDA; ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast); ubiquitin-protein ligase; ubiquitin conjugating enzyme E2 K
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaacatcgcggtgcagcgaatcaagcgggagttcaaggaggtgctgaagagcgaggagacgagcaaaaatcaaattaaagtagatcttgtagatgagaattttacagaattaagaggagaaatagcaggacctccagacacaccatatgaaggaggaagataccaactagagataaaaataccagaaacatacccatttaatccccctaaggtccggtttatcactaaaatatggcatcctaatattagttccgtcacaggggctatttgtttggatatcctgaaagatcaatgggcagctgcaatgactctccgcacggtattattgtcattgcaagcactattggcagctgcagagccagatgatccacaggatgctgtagtagcaaatcagtacaaacaaaatcccgaaatgttcaaacagacagctcgactttgggcacatgtgtatgctggagcaccagtttctagtccagaatacaccaaaaaaatagaaaacctatgtgctatgggctttgataggaatgcagtaatagtggccttgtcttcaaaatcatgggatgtagagactgcaacagaattgcttctgagtaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: