Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HGF-hepatocyte growth factor (hepapoietin A, scatter factor) Gene
PTXBC063485
New product
Data sheet of HGF-hepatocyte growth factor (hepapoietin A, scatter factor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HGF-hepatocyte growth factor (hepapoietin A, scatter factor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063485 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HGF |
| Origin species: | Human |
| Product name: | HGF-hepatocyte growth factor (hepapoietin A, scatter factor) Gene |
| Size: | 2ug |
| Accessions: | BC063485 |
| Gene id: | 3082 |
| Gene description: | hepatocyte growth factor (hepapoietin A; scatter factor) |
| Synonyms: | DFNB39; F-TCF; HGFB; HPTA; fibroblast-derived tumor cytotoxic factor; hepatocyte growth factor (hepapoietin A; scatter factor); hepatopoietin-A; lung fibroblast-derived mitogen |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgggtgaccaaactcctgccagccctgctgctgcagcatgtcctcctgcatctcctcctgctccccatcgccatcccctatgcagagggacaaaggaaaagaagaaatacaattcatgaattcaagaaatcagcaaagactaccctaatcaaaatagatccagcactgaagataaaaaccaaaaaagtgaatactgcagaccaatgtgctaatagatgtactaggaataaaggacttccattcacttgcaaggcttttgtttttgataaagcaagaaaacaatgcctctggttccccttcaatagcatgtcaagtggagtgaaaaaagaatttggccatgaatttgacctctatgaaaacaaagactacattagaaactgcatcattggtaaaggacgcagctacaagggaacagtatctatcactaagagtggcatcaaatgtcagccctggagttccatgataccacacgaacacagctttttgccttcgagctatcggggtaaagacctacaggaaaactactgtcgaaatcctcgaggggaagaagggggaccctggtgtttcacaagcaatccagaggtacgctacgaagtctgtgacattcctcagtgttcagaaggtaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pyridoxal-dependent decarboxylase domain containing 2 - proteasome (prosome, macropain) subunit, alpha type, 6 - deleted in lymphocytic leukemia 1 (non-protein coding) - ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 |