Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ASAP1-ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 Gene
PTXBC020631
New product
Data sheet of ASAP1-ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASAP1-ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020631 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASAP1 |
| Origin species: | Human |
| Product name: | ASAP1-ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 Gene |
| Size: | 2ug |
| Accessions: | BC020631 |
| Gene id: | 50807 |
| Gene description: | ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 |
| Synonyms: | AMAP1; CENTB4; DDEF1; PAG2; PAP; ZG14P; arf-GAP with SH3 domain, ANK repeat and PH domain-containing protein 1; 130 kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating protein; 130 kDa phosphatidylinositol 4,5-bisphosphate-dependent ARF1 GTPase-activating protein; ADP-ribosylation factor-directed GTPase-activating protein 1; ARF GTPase-activating protein 1; DEF-1; PIP2-dependent ARF1 GAP; centaurin, beta 4; development and differentiation-enhancing factor 1; ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgcacatctctcagatgtgttgaagcatccattgcatccattttttattattttcttagttttgttcttggacaaatttaaacttttaaaagattattcaagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vacuolar protein sorting 37 homolog A (S. cerevisiae) - killer cell lectin-like receptor subfamily C, member 4 - glycosylphosphatidylinositol specific phospholipase D1 - cytochrome P450, family 2, subfamily C, polypeptide 9 |