Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GPLD1-glycosylphosphatidylinositol specific phospholipase D1 Gene
PTXBC020748
New product
Data sheet of GPLD1-glycosylphosphatidylinositol specific phospholipase D1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPLD1-glycosylphosphatidylinositol specific phospholipase D1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020748 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPLD1 |
| Origin species: | Human |
| Product name: | GPLD1-glycosylphosphatidylinositol specific phospholipase D1 Gene |
| Size: | 2ug |
| Accessions: | BC020748 |
| Gene id: | 2822 |
| Gene description: | glycosylphosphatidylinositol specific phospholipase D1 |
| Synonyms: | GPIPLD; GPIPLDM; PIGPLD; PIGPLD1; PLD; phosphatidylinositol-glycan-specific phospholipase D; GPI-PLD; GPI-specific phospholipase D; PI-G PLD; glycoprotein phospholipase D; glycosylphosphatidylinositol specific phospholipase D1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgctttcaggttgtggcctggcctgctgatcatgttgggttctctctgccatagaggttcaccgtgtggcctttcaacacacatagaaataggacacagagctctggagtttcttcagcttcacaatgggcgtgttaactacagagagctgttactagaacaccaggatgcgtatcaggctggaatcgtgtttcctgattgtttttaccctagcatctgcaaaggaggaaaattccatgatgtgtctgagagcactcactggactccgtttcttaatgcaagcgttcattatatccgagagaactatccccttccctgggagaaggacacagagaaactggtagctttcttgtttggaattacttctcacatggcggcagatgtcagctggcatagtctgggccttgaacaaggattccttaggaccatgggagctattgattttcacggctcctattcagaggctcattcggctggtgattttggtactgtttatttacatttgctaaattttctcgtggtatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 2, subfamily C, polypeptide 9 - proteasome (prosome, macropain) subunit, alpha type, 4 - proteasome (prosome, macropain) subunit, alpha type, 3 - suppressor of variegation 3-9 homolog 2 (Drosophila) |