Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SUV39H2-suppressor of variegation 3-9 homolog 2 (Drosophila) Gene
PTXBC029360
New product
Data sheet of SUV39H2-suppressor of variegation 3-9 homolog 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SUV39H2-suppressor of variegation 3-9 homolog 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029360 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUV39H2 |
| Origin species: | Human |
| Product name: | SUV39H2-suppressor of variegation 3-9 homolog 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC029360 |
| Gene id: | 79723 |
| Gene description: | suppressor of variegation 3-9 homolog 2 (Drosophila) |
| Synonyms: | histone-lysine N-methyltransferase SUV39H2; KMT1B; H3-K9-HMTase 2; histone H3-K9 methyltransferase 2; lysine N-methyltransferase 1B; su(var)3-9 homolog 2; suppressor of variegation 3-9 homolog 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggtcggggccgaggcgcgaggagcttggtgtgtgccttgcctagtttcacttgatactcttcaggaattatgtagaaaagaaaagctcacatgtaaatcgattggaatcaccaaaaggaatctaaacaattatgaggtggaatacttgtgtgactacaaggtagtaaaggatatggaatattatcttgtaaaatggaaaggatggccagattctacaaatacttgggaacctttgcaaaatctgaagtgcccgttactgcttcagcaattctctaatgacaagcataattatttatctcaggtaatcacaagtgaagaagctgaaagacgaggacagttctatgacaacaagggaatcacgtatctctttgatctggactatgagtctgatgaattcacagtggatgcggctcgatacggcaatgtgtctcattttgtgaatcacagctgtgacccaaatcttcaggtgttcaatgttttcattgataacctcgatactcgtcttccccgaatagcattgttttccacaagaaccataaatgctggagaagagctgacttttgattatcaaatgaaaggttctggagatatatcttcagattctattgaccacagcccagccaaaaagagggtcagaacagtatgtaaatgtggagctgtgacttgcagaggttacctcaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hepatocyte growth factor (hepapoietin A; scatter factor) - Fc fragment of IgG, low affinity IIa, receptor (CD32) - budding uninhibited by benzimidazoles 3 homolog (yeast) - N-acetylated alpha-linked acidic dipeptidase-like 2 |