No products
Prices are tax excluded
PTXBC020823
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020823 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCGR2A |
| Origin species: | Human |
| Product name: | FCGR2A-Fc fragment of IgG, low affinity IIa, receptor (CD32) Gene |
| Size: | 2ug |
| Accessions: | BC020823 |
| Gene id: | 2212 |
| Gene description: | Fc fragment of IgG, low affinity IIa, receptor (CD32) |
| Synonyms: | CD32A; CDw32; FCG2; FCGR2; FCGR2A1; FcGR; IGFR2; low affinity immunoglobulin gamma Fc region receptor II-a; Fc fragment of IgG, low affinity IIa, receptor (CD32); Immunoglobulin G Fc receptor II; fc-gamma-RIIa; fcRII-a; igG Fc receptor II-a; Fc fragment of IgG receptor IIa |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactatggagacccaaatgtctcagaatgtatgtcccagaaacctgtggctgcttcaaccattgacagttttgctgctgctggcttctgcagacagtcaagctgctcccccaaaggctgtgctgaaacttgagcccccgtggatcaacgtgctccaggaggactctgtgactctgacatgccagggggctcgcagccctgagagcgactccattcagtggttccacaatgggaatctcattcccacccacacgcagcccagctacaggttcaaggccaacaacaatgacagcggggagtacacgtgccagactggccagaccagcctcagcgaccctgtgcatctgactgtgctttccgaatggctggtgctccagacccctcacctggagttccaggagggagaaaccatcatgctgaggtgccacagctggaaggacaagcctctggtcaaggtcacattcttccagaatggaaaatcccagaaattctcccatttggatcccaccttctccatcccacaagcaaaccacagtcacagtggtgattaccactgcacaggaaacataggctacacgctgttctcatccaagcctgtgaccatcactgtccaagtgcccagcatgggcagctcttcaccaatgggggtcattgtggctgtggtcattgcgactgctgtagcagccattgttgctgctgtagtggccttgatctactgcaggaaaaagcggatttcagccaattccactgatcctgtgaaggctgcccaatttgagccacctggacgtcaaatgattgccatcagaaagagacaacttgaagaaaccaacaatgactatgaaacagctgacggcggctacatgactctgaaccccagggcacctactgacgatgataaaaacatctacctgactcttcctcccaacgaccatgtcaacagtaataactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - budding uninhibited by benzimidazoles 3 homolog (yeast) - N-acetylated alpha-linked acidic dipeptidase-like 2 - cytochrome P450, family 4, subfamily B, polypeptide 1 - dehydrogenase/reductase (SDR family) member 4 like 2 |