Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DHRS4L2-dehydrogenase/reductase (SDR family) member 4 like 2 Gene
PTXBC000663
New product
Data sheet of DHRS4L2-dehydrogenase/reductase (SDR family) member 4 like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DHRS4L2-dehydrogenase/reductase (SDR family) member 4 like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000663 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DHRS4L2 |
| Origin species: | Human |
| Product name: | DHRS4L2-dehydrogenase/reductase (SDR family) member 4 like 2 Gene |
| Size: | 2ug |
| Accessions: | BC000663 |
| Gene id: | 317749 |
| Gene description: | dehydrogenase/reductase (SDR family) member 4 like 2 |
| Synonyms: | SDR25C3; dehydrogenase/reductase SDR family member 4-like 2; NADP(H)-dependent retinol dehydrogenase/reductase short isoform-like protein; NADPH-dependent retinol dehydrogenase/reductase-like protein 2; dehydrogenase/reductase (SDR family) member 4 like 2; dehydrogenase/reductase (SDR family) member 4 like 2A3; short chain dehydrogenase/reductase family 25C member 3; dehydrogenase/reductase 4 like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaggctgctaggcctctgtgcctgggcacggaagtcggtgcggttggccagctccaggatgacccgccgggacccgctcacaaataaggtggccctggtaacggcctccaccgacgggatcggcttcgccatcgcccggcgtttggcccaggacagggcccacgtggtcgtcagcagccggaagcagcagaatgtggaccaggcggtggccacgctgcagggggaggggctgagcgtgacgggcactgtgtgccatgtggggaaggcggaggaccgggagcggctggtggccatggctgtgaagcttcatggaggtatcgatatcctagtctccaatgctgctgtcaaccctttctttggaagcctaatggatgtcaccgaggaggtgtgggacaagactctggacattaatgtgaaggccccagccctgatgacaaaggcagtggtgccagaaatggagaaacgaggaggcggctcagtggtgatcgtgtcttccatagcagccttcagtccatctcctggcttcagtccttacaatgtcagtaaaacagccttgctgggcctcaacaataccctggccatagagctggccccaaggaacattagggtgaactgcctgcacctggacttatcaagactagcttcagcaggatgctctggatggacaaggaaaaagaggaaagcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - killer cell lectin-like receptor subfamily C, member 1 - Bernardinelli-Seip congenital lipodystrophy 2 (seipin) - killer cell lectin-like receptor subfamily A, member 1 - cytochrome P450, family 3, subfamily A, polypeptide 4 |