BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene View larger

BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC041640
Product type: DNA & cDNA
Ncbi symbol: BSCL2
Origin species: Human
Product name: BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene
Size: 2ug
Accessions: BC041640
Gene id: 26580
Gene description: Bernardinelli-Seip congenital lipodystrophy 2 (seipin)
Synonyms: BSCL2, seipin lipid droplet biogenesis associated; GNG3LG; HMN5; PELD; SPG17; seipin; Berardinelli-Seip congenital lipodystrophy 2 (seipin); Bernardinelli-Seip congenital lipodystrophy type 2 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcaacgaccctccagtacctgccttactgtgggcccaggaggtgggccaagtcttggcaggccgtgcccgcaggctgctgctgcagtttggggtgctcttctgcaccatcctccttttgctctgggtgtctgtcttcctctatggctccttctactattcctatatgccgacagtcagccacctcagccctgtgcatttctactacaggaccgactgtgattcctccaccacctcactctgctccttccctgttgccaatgtctcgctgactaagggtggacgtgatcgggtgctgatgtatggacagccgtatcgtgttaccttagagcttgagctgccagagtcccctgtgaatcaagatttgggcatgttcttggtcaccatttcctgctacaccagaggtggccgaatcatctccacttcttcgcgttcggtgatgctgcattaccgctcagacctgctccagatgctggacacactggtcttctctagcctcctgctatttggctttgcagagcagaagcagctgctggaggtggaactctacgcagactatagagagaactcgtacgtgccgaccactggagcgatcattgagatccacagcaagcgcatccagctgtatggagcctacctccgcatccacgcgcacttcactgggctcagatacctgctatacaacttcccgatgacctgcgccttcataggtgttgccagcaacttcaccttcctcagcgtcatcgtgctcttcagctacatgcagtgggtgtgggggggcatctggccccgacaccgcttctctttgcaggttaacatccgaaaaagagacaattcccggaaggaagtccaacgaaggatctctgctcatcagccagggcctgaaggccaggaggagtcaactccgcaatcagatgttacagaggatggtgagagccctgaagatccctcagggacagagggtcagctgtccgaggaggagaaaccagatcagcagcccctgagcggagaagaggagctagagcctgaggccagtgatggttcaggctcctgggaagatgcagctttgctgacggaggccaacctgcctgctcctgctcctgcttctgcttctgcccctgtcctagagactctgggcagctctgaacctgctgggggtgctctccgacagcgccccacctgctctagttcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - killer cell lectin-like receptor subfamily A, member 1
- cytochrome P450, family 3, subfamily A, polypeptide 4
- protein disulfide isomerase-like protein of the testis
- pyridoxal-dependent decarboxylase domain containing 1

Buy BSCL2-Bernardinelli-Seip congenital lipodystrophy 2 (seipin) Gene now

Add to cart