Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KLRA1-killer cell lectin-like receptor subfamily A, member 1 Gene
PTXBC069734
New product
Data sheet of KLRA1-killer cell lectin-like receptor subfamily A, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KLRA1-killer cell lectin-like receptor subfamily A, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069734 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KLRA1 |
| Origin species: | Human |
| Product name: | KLRA1-killer cell lectin-like receptor subfamily A, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC069734 |
| Gene id: | 10748 |
| Gene description: | killer cell lectin-like receptor subfamily A, member 1 |
| Synonyms: | CRE-BP1; CREB-2; CREB2; HB16; TREB7; cyclic AMP-dependent transcription factor ATF-2; activating transcription factor 2 splice variant ATF2-var2; cAMP response element-binding protein CRE-BP1; cAMP responsive element binding protein 2, formerly; cAMP-dependent transcription factor ATF-2; cyclic AMP-responsive element-binding protein 2; histone acetyltransferase ATF2; activating transcription factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgatcagggagagatttattcaaccctgagatttttgcagtctccttcagagtcacagaatagattaaggcctgatgatactcaaaggcctgggaaaactgatgacaaagaattttcagtgccctggcacctcattgcagtgactcttgggatcctctgtttacttcttctgatgatagtcacagtgttggtgacaaatatctttcagtgtattcaagaaaaacatcaacggcaggaaattctaagaaactgtagtgaaaagtacatcatgcaaaatgacaactacttaaaagagcagattttgacaaataagactttaaaatatgacgttctcaaaaatagctttcagcagaaaaaggaactggattcacgccttatacaaaagaacagatgtcatagagaaaatgagatcgtttttaaagttttgcaaaatacaggcaaattctctgaagaccacgggtcctgttgtggagtaaactgttattattttaccatgcagaagaaagactggaagggatgtaaacagacttgtcaacattgtagatcatcccttttgaagatagatgacaaagatgaactcgtattttacattcacttttattctcttggactctgtttctcaatgttggacctaagatattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 3, subfamily A, polypeptide 4 - protein disulfide isomerase-like protein of the testis - pyridoxal-dependent decarboxylase domain containing 1 - vacuolar protein sorting 37 homolog A (S. cerevisiae) |