MSMB-microseminoprotein, beta- Gene View larger

MSMB-microseminoprotein, beta- Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MSMB-microseminoprotein, beta- Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MSMB-microseminoprotein, beta- Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005257
Product type: DNA & cDNA
Ncbi symbol: MSMB
Origin species: Human
Product name: MSMB-microseminoprotein, beta- Gene
Size: 2ug
Accessions: BC005257
Gene id: 4477
Gene description: microseminoprotein, beta-
Synonyms: HPC13; IGBF; MSP; MSPB; PN44; PRPS; PSP; PSP-94; PSP57; PSP94; beta-microseminoprotein; immunoglobulin binding factor; prostate secreted seminal plasma protein; prostate secretory protein of 94 amino acids; seminal plasma beta-inhibin; microseminoprotein beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgttctcctgggcagcgttgtgatctttgccaccttcgtgactttatgcaatgcatcatgctatttcatacctaatgagggagttccaggagattcaaccaggaaatgcatggatctcaaaggaaacaaacacccaataaactcggagtggcagactgacaactgtgagacatgcacttgctacgaaacagaaatttcatgttgcacccttgtttctacacctgtgggttatgacaaagacaactgccaaagaatcttcaagaaggaggactgcaagtatatcgtggtggagaagaaggacccaaaaaagacctgttctgtcagtgaatggataatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kinesin family member 19
- stearoyl-CoA desaturase 5
- zinc finger protein 738
- zinc finger protein 839

Buy MSMB-microseminoprotein, beta- Gene now

Add to cart