CA14-carbonic anhydrase XIV Gene View larger

CA14-carbonic anhydrase XIV Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CA14-carbonic anhydrase XIV Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CA14-carbonic anhydrase XIV Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034412
Product type: DNA & cDNA
Ncbi symbol: CA14
Origin species: Human
Product name: CA14-carbonic anhydrase XIV Gene
Size: 2ug
Accessions: BC034412
Gene id: 23632
Gene description: carbonic anhydrase XIV
Synonyms: CAXiV; carbonic anhydrase 14; CA-XIV; carbonate dehydratase XIV; carbonic anhydrase XIV; carbonic dehydratase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgttctccgccctcctgctggaggtgatttggatcctggctgcagatgggggtcaacactggacgtatgagggcccacatggtcaggaccattggccagcctcttaccctgagtgtggaaacaatgcccagtcgcccatcgatattcagacagacagtgtgacatttgaccctgatttgcctgctctgcagccccacggatatgaccagcctggcaccgagcctttggacctgcacaacaatggccacacagtgcaactctctctgccctctaccctgtatctgggtggacttccccgaaaatatgtagctgcccagctccacctgcactggggtcagaaaggatccccaggggggtcagaacaccagatcaacagtgaagccacatttgcagagctccacattgtacattatgactctgattcctatgacagcttgagtgaggctgctgagaggcctcagggcctggctgtcctgggcatcctaattgaggtgggtgagactaagaatatagcttatgaacacattctgagtcacttgcatgaagtcaggcataaagatcagaagacctcagtgcctcccttcaacctaagagagctgctccccaaacagctggggcagtacttccgctacaatggctcgctcacaactcccccttgctaccagagtgtgctctggacagttttttatagaaggtcccagatttcaatggaacagctggaaaagcttcaggggacattgttctccacagaagaggagccctctaagcttctggtacagaactaccgagcccttcagcctctcaatcagcgcatggtctttgcttctttcatccaagcaggatcctcgtataccacaggtgaaatgctgagtctaggtgtaggaatcttggttggctgtctctgccttctcctggctgtttatttcattgctagaaagattcggaagaagaggctggaaaaccgaaagagtgtggtcttcacctcagcacaagccacgactgaggcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transducer of ERBB2, 1
- angiopoietin-like 7
- sorbitol dehydrogenase
- WD repeat domain 51A

Buy CA14-carbonic anhydrase XIV Gene now

Add to cart