WDR51A-WD repeat domain 51A Gene View larger

WDR51A-WD repeat domain 51A Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR51A-WD repeat domain 51A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about WDR51A-WD repeat domain 51A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007417
Product type: DNA & cDNA
Ncbi symbol: WDR51A
Origin species: Human
Product name: WDR51A-WD repeat domain 51A Gene
Size: 2ug
Accessions: BC007417
Gene id: 25886
Gene description: WD repeat domain 51A
Synonyms: WDR51A; PIX2; SOFT; POC1 centriolar protein homolog A; WD repeat domain 51A; WD repeat-containing protein 51A; proteome of centriole protein 1A; POC1 centriolar protein A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtctggcacatgaagccgcagtcacgcgcctaccgcttcactggccacaaggatgccgtcacctgtgtgaacttctctccttcgggacacctgcttgcttccggctcccgagacaagactgtccgcatctgggtacccaatgtcaaaggtgagtccactgtgtttcgtgcacacacagccacagtgaggagtgtccacttctgcagtgatggccagtccttcgtgacagcctctgacgacaagacagtcaaagtgtgggcaactcatcgccagaaattcctgttctccctgagccagcatatcaactgggtccgctgtgccaagttctcccccgacgggcggctcatcgtgtctgccagtgatgacaagactgttaagctgtgggacaagagcagccgggaatgtgtccactcgtattgtgagcatggcggctttgtcacctatgtggacttccaccccagtgggacgtgcattgccgctgccggcatggacaacacagtgaaggtgtgggacgtgcggactcaccggctgctgcagcattatcagttgcacagtgcagcagtgaacgggctctctttccacccgtcgggaaactacctgatcacagcctccagtgactcaaccctgaagatcctggacctgatggagggccggctgctctacacactccacgggcatcagggaccagccaccactgttgccttttcaagaacgggggagtattttgcttctggaggctctgatgaacaagtgatggtttggaagagtaactttgatattgttgatcatggagaagtcacgaaagtgccgaggcccccagccacactggccagctccatggggaatctgccagaagtggacttccctgtccccccaggcagaggcaggagtgtggagtctgtgcagagccagccccaggagcccgtgagtgtgccccagacactgactagcacgctggagcacattgtgggccagctggatgtcctcactcagacagtctccattctggagcagcggttgacactgacagaagacaagctgaagcagtgtctggagaaccagcagctaatcatgcagagagcaacaccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tubulin tyrosine ligase
- ethanolamine kinase 2
- ring finger protein 1
- thymine-DNA glycosylase

Buy WDR51A-WD repeat domain 51A Gene now

Add to cart