SORD-sorbitol dehydrogenase Gene View larger

SORD-sorbitol dehydrogenase Gene

PTXBC021085

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SORD-sorbitol dehydrogenase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SORD-sorbitol dehydrogenase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021085
Product type: DNA & cDNA
Ncbi symbol: SORD
Origin species: Human
Product name: SORD-sorbitol dehydrogenase Gene
Size: 2ug
Accessions: BC021085
Gene id: 6652
Gene description: sorbitol dehydrogenase
Synonyms: HEL-S-95n; SORD1; L-iditol 2-dehydrogenase; epididymis secretory sperm binding protein Li 95n
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggcggccaagcccaacaacctttccctggtggtgcacggaccgggggacttgcgcctggagaactatcctatccctgaaccaggcccaaatgaggtcttgctgaggatgcattctgttggaatctgtggctcagatgtccactactgggagtatggtcgaattgggaattttattgtgaaaaagcccatggtgctgggacatgaagcttcgggaacagtcgaaaaagtgggatcatcggtaaagcacctaaaaccaggtgatcgtgttgccatcgagcctggtgctccccgagaaaatgatgaattctgcaagatgggccgatacaatctgtcaccttccatcttcttctgtgccacgccccccgatgacgggaacctctgccggttctataagcacaatgcagccttttgttacaagcttcctgacaatgtcacctttgaggaaggcgccctgatcgagccactttctgtggggatccatgcctgcaggagaggcggagttaccctgggacacaaggtccttgtgtgtggagctgggccaatcgggatggtcactttgctcgtggccaaagcaatgggagcagctcaagtagtggtgactgatctgtctgctacccgattgtccaaagccaaggagattggggctgatttagtcctccagatctccaaggagagccctcaggaaatcgccaggaaagtagaaggtcagctggggtgcaagccggaagtcaccatcgagtgcacgggggcagaggcctccatccaggcgggcatctacgccactcgctctggtgggaccctcgtgcttgtggggctgggctctgagatgaccaccgtacccctactgcatgcagccatccgggaggtggatatcaagggcgtgtttcgatactgcaacacgtggccagtggcgatttcgatgcttgcgtccaagtctgtgaatgtaaaacccctcgtcacccataggtttcctctggagaaagctctggaggcctttgaaacatttaaaaagggattggggttgaaaatcatgctcaagtgtgaccccagtgaccagaatccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WD repeat domain 51A
- tubulin tyrosine ligase
- ethanolamine kinase 2
- ring finger protein 1

Buy SORD-sorbitol dehydrogenase Gene now

Add to cart