Login to display prices
Login to display prices
CRIPT-cysteine-rich PDZ-binding protein Gene View larger

CRIPT-cysteine-rich PDZ-binding protein Gene

PTXBC006980

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CRIPT-cysteine-rich PDZ-binding protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CRIPT-cysteine-rich PDZ-binding protein Gene

Proteogenix catalog: PTXBC006980
Ncbi symbol: CRIPT
Product name: CRIPT-cysteine-rich PDZ-binding protein Gene
Size: 2ug
Accessions: BC006980
Gene id: 9419
Gene description: cysteine-rich PDZ-binding protein
Synonyms: postsynaptic protein CRIPT; HSPC139; SSMDF; cysteine-rich PDZ-binding protein; cysteine-rich interactor of PDZ three; cysteine-rich interactor of PDZ3; CXXC repeat containing interactor of PDZ3 domain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtgcgaaaaatgtgaaaagaaacttggtactgttatcactccagatacatggaaagatggtgctaggaataccacagaaagtggtggaagaaagctgaatgaaaataaagctttgacttcaaaaaaagcaagatttgatccatatggaaagaataagttctccacttgtagaatttgtaaaagttctgtgcaccaaccaggttctcattactgccagggctgtgcctacaaaaaaggcatctgtgcgatgtgtggaaaaaaggttttggataccaaaaactacaagcaaacatctgtctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: