Login to display prices
Login to display prices
PI3-peptidase inhibitor 3, skin-derived Gene View larger

PI3-peptidase inhibitor 3, skin-derived Gene

PTXBC010952

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PI3-peptidase inhibitor 3, skin-derived Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PI3-peptidase inhibitor 3, skin-derived Gene

Proteogenix catalog: PTXBC010952
Ncbi symbol: PI3
Product name: PI3-peptidase inhibitor 3, skin-derived Gene
Size: 2ug
Accessions: BC010952
Gene id: 5266
Gene description: peptidase inhibitor 3, skin-derived
Synonyms: ESI; SKALP; WAP3; WFDC14; cementoin; PI-3; WAP four-disulfide core domain 14; WAP four-disulfide core domain protein 14; elastase-specific inhibitor; peptidase inhibitor 3, skin-derived; pre-elafin; protease inhibitor 3, skin-derived (SKALP); protease inhibitor WAP3; skin-derived antileukoproteinase; trappin-2; peptidase inhibitor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggccagcagcttcttgatcgtggtggtgttcctcatcgctgggacgctggttctagaggcagctgtcacgggagttcctgttaaaggtcaagacactgtcaaaggccgtgttccattcaatggacaagatcccgttaaaggacaagtttcagttaaaggtcaagataaagtcaaagcgcaagagccagtcaaaggtccagtctccactaagcctggctcctgccccattatcttgatccggtgcgccatgttgaatccccctaaccgctgcttgaaagatactgactgcccaggaatcaagaagtgctgtgaaggctcttgcgggatggcctgtttcgttccccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: