PI3-peptidase inhibitor 3, skin-derived Gene View larger

PI3-peptidase inhibitor 3, skin-derived Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PI3-peptidase inhibitor 3, skin-derived Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PI3-peptidase inhibitor 3, skin-derived Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010952
Product type: DNA & cDNA
Ncbi symbol: PI3
Origin species: Human
Product name: PI3-peptidase inhibitor 3, skin-derived Gene
Size: 2ug
Accessions: BC010952
Gene id: 5266
Gene description: peptidase inhibitor 3, skin-derived
Synonyms: ESI; SKALP; WAP3; WFDC14; cementoin; PI-3; WAP four-disulfide core domain 14; WAP four-disulfide core domain protein 14; elastase-specific inhibitor; peptidase inhibitor 3, skin-derived; pre-elafin; protease inhibitor 3, skin-derived (SKALP); protease inhibitor WAP3; skin-derived antileukoproteinase; trappin-2; peptidase inhibitor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggccagcagcttcttgatcgtggtggtgttcctcatcgctgggacgctggttctagaggcagctgtcacgggagttcctgttaaaggtcaagacactgtcaaaggccgtgttccattcaatggacaagatcccgttaaaggacaagtttcagttaaaggtcaagataaagtcaaagcgcaagagccagtcaaaggtccagtctccactaagcctggctcctgccccattatcttgatccggtgcgccatgttgaatccccctaaccgctgcttgaaagatactgactgcccaggaatcaagaagtgctgtgaaggctcttgcgggatggcctgtttcgttccccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - shisa homolog 5 (Xenopus laevis)
- signal recognition particle 19kDa
- mal, T-cell differentiation protein
- cytoskeleton associated protein 2

Buy PI3-peptidase inhibitor 3, skin-derived Gene now

Add to cart