MAL-mal, T-cell differentiation protein Gene View larger

MAL-mal, T-cell differentiation protein Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAL-mal, T-cell differentiation protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAL-mal, T-cell differentiation protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000458
Product type: DNA & cDNA
Ncbi symbol: MAL
Origin species: Human
Product name: MAL-mal, T-cell differentiation protein Gene
Size: 2ug
Accessions: BC000458
Gene id: 4118
Gene description: mal, T-cell differentiation protein
Synonyms: mal, T-cell differentiation protein; myelin and lymphocyte protein; MyD88-adapter-like; T-lymphocyte maturation-associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccccgcagcggcgacggggggcagcaccctgcccagtggcttctcggtcttcaccaccttgcccgacttgctcttcatctttgagtttatcttcgggggcctggtgtggatcctggtggcctcctccctggtgccctggcccctggtccagggctgggtgatgttcgtgtctgtgttctgcttcgtggccaccaccaccttgatcatcctgtacataattggagcccacggtggagagacttcctgggtcaccttggacgcagcctaccactgcaccgctgccctcttttacctcagcgcctcagtcctggaggccctggccaccatcacgatgcaagacggcttcacctacaggcactaccatgaaaacattgctgccgtggtgttctcctacatagccactctgctctacgtggtccatgcggtgttctctttaatcagatggaagtcttcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytoskeleton associated protein 2
- GTP-binding protein 8 (putative)
- cancer susceptibility candidate 4
- coiled-coil domain containing 53

Buy MAL-mal, T-cell differentiation protein Gene now

Add to cart