CCDC53-coiled-coil domain containing 53 Gene View larger

CCDC53-coiled-coil domain containing 53 Gene

PTXBC010889

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC53-coiled-coil domain containing 53 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC53-coiled-coil domain containing 53 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010889
Product type: DNA & cDNA
Ncbi symbol: CCDC53
Origin species: Human
Product name: CCDC53-coiled-coil domain containing 53 Gene
Size: 2ug
Accessions: BC010889
Gene id: 51019
Gene description: coiled-coil domain containing 53
Synonyms: WASH complex subunit CCDC53; CCDC53; CGI-116; coiled-coil domain containing 53; coiled-coil domain-containing protein 53; WASH complex subunit 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgaggacgggcttcctctcatggggtcaggcatagacctgaccaaggtgccagctattcaacagaaaagaacggtggcttttctaaaccaatttgtggtgcacactgtacagttcctcaaccgcttttctacagtttgtgaggagaaactggcagacctttcacttcgtatccaacaaattgaaacaactctcaatattttagatgcaaagttgtcatctatcccaggcctagatgatgtcacagttgaagtatctcctttaaatgtcaccagtgtcacaaatggagcacatcctgaagccacttcagagcaaccacagcagagcagtacacaagactctggactacaggaaagtgaagtatcagcagaaaatatcttaactgtagccaaggatccaagatatgccagatatctcaaaatggttcaagtgggtgtaccagtgatggcaataagaaacaaaatgatatcagaaggactagacccagatcttcttgagaggccagatgctccagtgcctgatggcgaaagtgagaaaactgtagaagaaagttcagatagcgaatcttcttttagtgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB9A, member RAS oncogene family
- RAB30, member RAS oncogene family
- RAB6B, member RAS oncogene family
- RAB25, member RAS oncogene family

Buy CCDC53-coiled-coil domain containing 53 Gene now

Add to cart