Login to display prices
Login to display prices
RAB9A-RAB9A, member RAS oncogene family Gene View larger

RAB9A-RAB9A, member RAS oncogene family Gene

PTXBC017265

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB9A-RAB9A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB9A-RAB9A, member RAS oncogene family Gene

Proteogenix catalog: PTXBC017265
Ncbi symbol: RAB9A
Product name: RAB9A-RAB9A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC017265
Gene id: 9367
Gene description: RAB9A, member RAS oncogene family
Synonyms: RAB9A, member RAS oncogene family; RAB9; ras-related protein Rab-9A; RAB9, member RAS oncogene family
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggaaaatcatcactttttaaagtaattctccttggagatggtggagttgggaagagttcacttatgaacagatatgtaactaataagtttgatacccagctcttccatacaataggtgtggaatttttaaataaagatttggaagtggatggacattttgttaccatgcagatttgggacacggcaggtcaggagcgattccgaagcctgaggacaccattttacagaggttctgactgctgcctgcttacttttagtgtcgatgattcacaaagcttccagaacttaagtaactggaagaaagaattcatatattatgcagatgtgaaagagcctgagagctttccttttgtgattctgggtaacaagattgacataagcgaacggcaggtgtctacagaagaagcccaagcttggtgcagggacaacggcgactatccttattttgaaacaagtgcaaaagatgccacaaatgtggcagcagcctttgaggaagcggttcgaagagttcttgctaccgaggataggtcagatcatttgattcagacagacacagtcaatcttcaccgaaagcccaagcctagctcatcttgctgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: