RAB30-RAB30, member RAS oncogene family Gene View larger

RAB30-RAB30, member RAS oncogene family Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB30-RAB30, member RAS oncogene family Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAB30-RAB30, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014213
Product type: DNA & cDNA
Ncbi symbol: RAB30
Origin species: Human
Product name: RAB30-RAB30, member RAS oncogene family Gene
Size: 2ug
Accessions: BC014213
Gene id: 27314
Gene description: RAB30, member RAS oncogene family
Synonyms: RAB30, member RAS oncogene family; ras-related protein Rab-30
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtatggaagattatgatttcctgttcaaaattgttttaattggcaacgctggtgtggggaagacgtgcctcgtccgaagattcactcagggtcttttccccccaggtcaaggagccacaattggagttgattttatgattaagacagtggagattaatggtgaaaaagtaaagctacagatctgggacacagcaggtcaagagagatttcggtccattacccagagttactaccgaagcgccaatgccttgatcctcacctatgacattacctgtgaggaatccttccgttgccttcctgagtggctgcgggagatagaacaatatgccagcaacaaggtcatcactgtgttagtgggcaacaagattgacctggctgaaaggagagaggtttcccagcagcgagctgaagaattctcagaagctcaggacatgtattatctggagacctcagccaaggaatctgataatgtggagaaactcttccttgacttagcatgccgactcatcagtgaagccagacagaacacacttgtgaacaatgtatcctcacccttacctggagaagggaaaagcatcagctatttgacttgttgtaatttcaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB6B, member RAS oncogene family
- RAB25, member RAS oncogene family
- lactate dehydrogenase A-like 6A
- pentatricopeptide repeat domain 2

Buy RAB30-RAB30, member RAS oncogene family Gene now

Add to cart