PTCD2-pentatricopeptide repeat domain 2 Gene View larger

PTCD2-pentatricopeptide repeat domain 2 Gene

PTXBC018720

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTCD2-pentatricopeptide repeat domain 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTCD2-pentatricopeptide repeat domain 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018720
Product type: DNA & cDNA
Ncbi symbol: PTCD2
Origin species: Human
Product name: PTCD2-pentatricopeptide repeat domain 2 Gene
Size: 2ug
Accessions: BC018720
Gene id: 79810
Gene description: pentatricopeptide repeat domain 2
Synonyms: pentatricopeptide repeat-containing protein 2, mitochondrial; CTC-365E16.1; pentatricopeptide repeat domain 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagaccagcatttacgaggtttcttctcagactccacatcattcaatattttgatggatatgttatttatcaaaggcaaatataaaagtgctttgcaagtattgatagagatgaaaaaccaagatgtgaagttcaccaaagatacctatgttcttgcttttgcaatttgctacaaactgaatagccctgagtctttcaaaatctgtactacattaagagaagaagctctactcaaaggagaaattctctccaggagagcatcctgtttcgctgtggcattagctctgaatcagaatgagatggcaaaagctgtgtccattttttctcaaatcatgaatccagaaagcatagcctgcattaatttaaatattataatccatatccagtcaaatatgttggaaaacctgataaagactctaaaaaatgctgcagaaggaaatttatcaaaatttgtgaaaagacatgtgttctcggaggaagtgctggccaaagtgagggaaaaagtgaaggatgtgcctgcccttgtggccaaatttgatgagatctatgggacactgcacatcactggccaggtcaccactgattctttggatgctgtgctctgccacacccccagggacaggaaatctcacacgttgctattaaacaagaggatggtcagccgtcgcaccttccagccactcagccagtccctgttggctgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - quinoid dihydropteridine reductase
- intercellular adhesion molecule 2
- HUS1 checkpoint homolog (S. pombe)
- voltage-dependent anion channel 1

Buy PTCD2-pentatricopeptide repeat domain 2 Gene now

Add to cart