Login to display prices
Login to display prices
PTCD2-pentatricopeptide repeat domain 2 Gene View larger

PTCD2-pentatricopeptide repeat domain 2 Gene

PTXBC018720

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTCD2-pentatricopeptide repeat domain 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTCD2-pentatricopeptide repeat domain 2 Gene

Proteogenix catalog: PTXBC018720
Ncbi symbol: PTCD2
Product name: PTCD2-pentatricopeptide repeat domain 2 Gene
Size: 2ug
Accessions: BC018720
Gene id: 79810
Gene description: pentatricopeptide repeat domain 2
Synonyms: pentatricopeptide repeat-containing protein 2, mitochondrial; CTC-365E16.1; pentatricopeptide repeat domain 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagaccagcatttacgaggtttcttctcagactccacatcattcaatattttgatggatatgttatttatcaaaggcaaatataaaagtgctttgcaagtattgatagagatgaaaaaccaagatgtgaagttcaccaaagatacctatgttcttgcttttgcaatttgctacaaactgaatagccctgagtctttcaaaatctgtactacattaagagaagaagctctactcaaaggagaaattctctccaggagagcatcctgtttcgctgtggcattagctctgaatcagaatgagatggcaaaagctgtgtccattttttctcaaatcatgaatccagaaagcatagcctgcattaatttaaatattataatccatatccagtcaaatatgttggaaaacctgataaagactctaaaaaatgctgcagaaggaaatttatcaaaatttgtgaaaagacatgtgttctcggaggaagtgctggccaaagtgagggaaaaagtgaaggatgtgcctgcccttgtggccaaatttgatgagatctatgggacactgcacatcactggccaggtcaccactgattctttggatgctgtgctctgccacacccccagggacaggaaatctcacacgttgctattaaacaagaggatggtcagccgtcgcaccttccagccactcagccagtccctgttggctgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: