VDAC1-voltage-dependent anion channel 1 Gene View larger

VDAC1-voltage-dependent anion channel 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VDAC1-voltage-dependent anion channel 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VDAC1-voltage-dependent anion channel 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008482
Product type: DNA & cDNA
Ncbi symbol: VDAC1
Origin species: Human
Product name: VDAC1-voltage-dependent anion channel 1 Gene
Size: 2ug
Accessions: BC008482
Gene id: 7416
Gene description: voltage-dependent anion channel 1
Synonyms: PORIN; VDAC-1; voltage-dependent anion-selective channel protein 1; outer mitochondrial membrane protein porin 1; plasmalemmal porin; porin 31HL; porin 31HM; voltage dependent anion channel 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtgccacccacgtatgccgatcttggcaaatctgccagggatgtcttcaccaagggctatggatttggcttaataaagcttgatttgaaaacaaaatctgagaatggattggaatttacaagctcaggctcagccaacactgagaccaccaaagtgacgggcagtctggaaaccaagtacagatggactgagtacggcctgacgtttacagagaaatggaataccgacaatacactaggcaccgagattactgtggaagatcagcttgcacgtggactgaagctgaccttcgattcatccttctcacctaacactgggaaaaaaaatgctaaaatcaagacagggtacaagcgggagcacattaacctgggctgcgacatggatttcgacattgctgggccttccatccggggtgctctggtgctaggttacgagggctggctggccggctaccagatgaattttgagactgcaaaatcccgagtgacccagagcaactttgcagttggctacaagactgatgaattccagcttcacactaatgtgaatgacgggacagagtttggcggctccatttaccagaaagtgaacaagaagttggagaccgctgtcaatcttgcctggacagcaggaaacagtaacacgcgcttcggaatagcagccaagtatcagattgaccctgacgcctgcttctcggctaaagtgaacaactccagcctgataggtttaggatacactcagactctaaagccaggtattaaactgacactgtcagctcttctggatggcaagaacgtcaatgctggtggccacaagcttggtctaggactggaatttcaagcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 94
- protein regulator of cytokinesis 1
- cell cycle associated protein 1
- CD44 molecule (Indian blood group)

Buy VDAC1-voltage-dependent anion channel 1 Gene now

Add to cart