HUS1-HUS1 checkpoint homolog (S. pombe) Gene View larger

HUS1-HUS1 checkpoint homolog (S. pombe) Gene

PTXBC007013

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HUS1-HUS1 checkpoint homolog (S. pombe) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HUS1-HUS1 checkpoint homolog (S. pombe) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007013
Product type: DNA & cDNA
Ncbi symbol: HUS1
Origin species: Human
Product name: HUS1-HUS1 checkpoint homolog (S. pombe) Gene
Size: 2ug
Accessions: BC007013
Gene id: 3364
Gene description: HUS1 checkpoint homolog (S. pombe)
Synonyms: HUS1 checkpoint clamp component; hus1+-like protein; HUS1 checkpoint homolog; checkpoint protein HUS1; hHUS1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtttcgggccaagatcgtggacggggcctgtctgaaccacttcacacgaatcagtaacatgatagccaagcttgccaaaacctgcaccctccgcatcagccctgataagcttaacttcatcctttgtgacaagctggctaatggaggagtgagcatgtggtgtgagctggaacaggagaacttcttcaacgaatttcaaatggagggtgtctctgcagaaaacaatgagatttatttagagctaacatcggaaaacttatctcgagccttgaagactgcccagaatgccagggctttgaaaatcaaactgactaataaacactttccctgcctcacggtctccgtggagctgttatctatgtcaagcagtagccgcattgtgacccatgacatccccataaaggtgattcctaggaaattgtggaaggacttacaagaaccggtggtcccagatcctgatgttagtatttatttaccagtcttgaagactatgaagagtgttgtggaaaaaatgaaaaacatcagcaatcaccttgttattgaagcaaacctagatggagaattgaatttgaaaatagaaactgaattagtatgtgttacaactcattttaaagatcttggaaatcctccattagcctctgaaagcacccatgaggacagaaacgtggaacacatggctgaagtgcacatagatattaggaagctcctacagtttcttgctggacaacaagtaaatcccacaaaggccttatgcaatattgtgaataacaagatggtgcattttgatctgcttcatgaagacgtgtcccttcagtatttcatccctgcgctgtcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - voltage-dependent anion channel 1
- coiled-coil domain containing 94
- protein regulator of cytokinesis 1
- cell cycle associated protein 1

Buy HUS1-HUS1 checkpoint homolog (S. pombe) Gene now

Add to cart