Login to display prices
Login to display prices
ICAM2-intercellular adhesion molecule 2 Gene View larger

ICAM2-intercellular adhesion molecule 2 Gene

PTXBC003097

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ICAM2-intercellular adhesion molecule 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ICAM2-intercellular adhesion molecule 2 Gene

Proteogenix catalog: PTXBC003097
Ncbi symbol: ICAM2
Product name: ICAM2-intercellular adhesion molecule 2 Gene
Size: 2ug
Accessions: BC003097
Gene id: 3384
Gene description: intercellular adhesion molecule 2
Synonyms: CD102; intercellular adhesion molecule 2; ICAM-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctctttcggttacaggaccctgactgtggccctcttcaccctgatctgctgtccaggatcggatgagaaggtattcgaggtacacgtgaggccaaagaagctggcggttgagcccaaagggtccctcgaggtcaactgcagcaccacctgtaaccagcctgaagtgggtggtctggagacctctctagataagattctgctggacgaacaggctcagtggaaacattacttggtctcaaacatctcccatgacacggtcctccaatgccacttcacctgctccgggaagcaggagtcaatgaattccaacgtcagcgtgtaccagcctccaaggcaggtcatcctgacactgcaacccactttggtggctgtgggcaagtccttcaccattgagtgcagggtgcccaccgtggagcccctggacagcctcaccctcttcctgttccgtggcaatgagactctgcactatgagaccttcgggaaggcagcccctgctccgcaggaggccacagccacattcaacagcacggctgacagagaggatggccaccgcaacttctcctgcctggctgtgctggacttgatgtctcgcggtggcaacatctttcacaaacactcagccccgaagatgttggagatctatgagcctgtgtcggacagccagatggtcatcatagtcacggtggtgtcggtgttgctgtccctgttcgtgacatctgtcctgctctgcttcatcttcggccagcacttgcgccagcagcggatgggcacctacggggtgcgagcggcttggaggaggctgccccaggccttccggccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: