ICAM2-intercellular adhesion molecule 2 Gene View larger

ICAM2-intercellular adhesion molecule 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ICAM2-intercellular adhesion molecule 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ICAM2-intercellular adhesion molecule 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003097
Product type: DNA & cDNA
Ncbi symbol: ICAM2
Origin species: Human
Product name: ICAM2-intercellular adhesion molecule 2 Gene
Size: 2ug
Accessions: BC003097
Gene id: 3384
Gene description: intercellular adhesion molecule 2
Synonyms: CD102; intercellular adhesion molecule 2; ICAM-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctctttcggttacaggaccctgactgtggccctcttcaccctgatctgctgtccaggatcggatgagaaggtattcgaggtacacgtgaggccaaagaagctggcggttgagcccaaagggtccctcgaggtcaactgcagcaccacctgtaaccagcctgaagtgggtggtctggagacctctctagataagattctgctggacgaacaggctcagtggaaacattacttggtctcaaacatctcccatgacacggtcctccaatgccacttcacctgctccgggaagcaggagtcaatgaattccaacgtcagcgtgtaccagcctccaaggcaggtcatcctgacactgcaacccactttggtggctgtgggcaagtccttcaccattgagtgcagggtgcccaccgtggagcccctggacagcctcaccctcttcctgttccgtggcaatgagactctgcactatgagaccttcgggaaggcagcccctgctccgcaggaggccacagccacattcaacagcacggctgacagagaggatggccaccgcaacttctcctgcctggctgtgctggacttgatgtctcgcggtggcaacatctttcacaaacactcagccccgaagatgttggagatctatgagcctgtgtcggacagccagatggtcatcatagtcacggtggtgtcggtgttgctgtccctgttcgtgacatctgtcctgctctgcttcatcttcggccagcacttgcgccagcagcggatgggcacctacggggtgcgagcggcttggaggaggctgccccaggccttccggccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - HUS1 checkpoint homolog (S. pombe)
- voltage-dependent anion channel 1
- coiled-coil domain containing 94
- protein regulator of cytokinesis 1

Buy ICAM2-intercellular adhesion molecule 2 Gene now

Add to cart