QDPR-quinoid dihydropteridine reductase Gene View larger

QDPR-quinoid dihydropteridine reductase Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of QDPR-quinoid dihydropteridine reductase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about QDPR-quinoid dihydropteridine reductase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000576
Product type: DNA & cDNA
Ncbi symbol: QDPR
Origin species: Human
Product name: QDPR-quinoid dihydropteridine reductase Gene
Size: 2ug
Accessions: BC000576
Gene id: 5860
Gene description: quinoid dihydropteridine reductase
Synonyms: DHPR; PKU2; SDR33C1; 6,7-dihydropteridine reductase; HDHPR; short chain dehydrogenase/reductase family 33C member 1; testis secretory sperm-binding protein Li 236P; quinoid dihydropteridine reductase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggcggcggctgcaggcgaggcgcgccgggtgctggtgtacggcggcaggggcgctctgggttctcgatgcgtgcaggcttttcgggcccgcaactggtgggttgccagcgttgatgtggtggagaatgaagaggccagcgctagcatcattgttaaaatgacagactcgttcactgagcaggctgaccaggtgactgctgaggttggaaagctcttgggtgaagagaaggtggatgcaattctttgcgttgctggaggatgggccgggggcaatgccaaatccaagtctctctttaagaactgtgacctgatgtggaagcagagcatatggacatcgaccatctccagccatctggctaccaagcatctcaaggaaggaggcctcctgaccttggctggcgcaaaggctgccctggatgggactcctggtatgatcgggtacggcatggccaagggtgctgttcaccagctctgccagagcctggctgggaagaacagcggcatgccgcccggggcagccgccatcgctgtgctcccggttaccctggataccccgatgaacaggaaatcaatgcctgaggctgacttcagctcctggacacccttagaattcctagttgaaactttccatgactggatcacagggaaaaaccgaccgagctcaggaagcctaatccaggtggtaaccacagaaggaaggacggaactcaccccagcatatttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - intercellular adhesion molecule 2
- HUS1 checkpoint homolog (S. pombe)
- voltage-dependent anion channel 1
- coiled-coil domain containing 94

Buy QDPR-quinoid dihydropteridine reductase Gene now

Add to cart