RAB25-RAB25, member RAS oncogene family Gene View larger

RAB25-RAB25, member RAS oncogene family Gene

PTXBC009831

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB25-RAB25, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB25-RAB25, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009831
Product type: DNA & cDNA
Ncbi symbol: RAB25
Origin species: Human
Product name: RAB25-RAB25, member RAS oncogene family Gene
Size: 2ug
Accessions: BC009831
Gene id: 57111
Gene description: RAB25, member RAS oncogene family
Synonyms: RAB25, member RAS oncogene family; CATX-8; RAB11C; ras-related protein Rab-25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaatggaactgaggaagattataactttgtcttcaaggtggtgctgatcggcgaatcaggtgtggggaagaccaatctactctcccgattcacgcgcaatgagttcagccacgacagccgcaccaccatcggggttgagttctccacccgcactgtgatgttgggcaccgctgctgtcaaggctcagatctgggacacagctggcctggagcggtaccgagccatcacctcggcgtactatcgtggtgcagtgggggccctcctggtgtttgacctaaccaagcaccagacctatgctgtggtggagcgatggctgaaggagctctatgaccatgctgaagccacgatcgtcgtcatgctcgtgggtaacaaaagtgacctcagccaggcccgggaagtgcccactgaggaggcccgaatgttcgctgaaaacaatggactgctcttcctggagacctcagccctggactctaccaatgttgagctagcctttgagactgtcctgaaagaaatctttgcgaaggtgtccaagcagagacagaacagcatccggaccaatgccatcactctgggcagtgcccaggctggacaggagcctggccctggggagaagagggcctgttgcatcagcctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lactate dehydrogenase A-like 6A
- pentatricopeptide repeat domain 2
- quinoid dihydropteridine reductase
- intercellular adhesion molecule 2

Buy RAB25-RAB25, member RAS oncogene family Gene now

Add to cart