Login to display prices
Login to display prices
CKAP2-cytoskeleton associated protein 2 Gene View larger

CKAP2-cytoskeleton associated protein 2 Gene

PTXBC010901

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CKAP2-cytoskeleton associated protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CKAP2-cytoskeleton associated protein 2 Gene

Proteogenix catalog: PTXBC010901
Ncbi symbol: CKAP2
Product name: CKAP2-cytoskeleton associated protein 2 Gene
Size: 2ug
Accessions: BC010901
Gene id: 26586
Gene description: cytoskeleton associated protein 2
Synonyms: LB1; TMAP; se20-10; cytoskeleton-associated protein 2; CTCL tumor antigen se20-10; tumor- and microtubule-associated protein; tumor-associated microtubule-associated protein; cytoskeleton associated protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaaagtcagagcccgttgaccagcgaagacatactgcaggaaaagcaattgttgatagtagatcagctcagcccaaagaaacctcggaagagagaaaagctcgtctgagtgagtggaaagctggcaaaggaagagtgctaaaaaggccccctaattcagtagttactcagcatgagcctgcaggacaaaatgaaaaaccagttgggtctttttggactaccatggcagaagaagatgaacaaagattatttactgaaaaagtaaacaacacattttctgaatgcctgaacttgattaatgagggatgtccaaaagaagatatactggtcacactgaatgacctgattaaaaatattccagatgccaaaaagcttgttaagtattggatatgtcttgcacttattgaaccaatcacaagtcctattgaaaatattattgcaatctatgagaaagccattctggcaggggctcaggtaagataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: