Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMA3-proteasome (prosome, macropain) subunit, alpha type, 3 Gene
PTXBC029402
New product
Data sheet of PSMA3-proteasome (prosome, macropain) subunit, alpha type, 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMA3-proteasome (prosome, macropain) subunit, alpha type, 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029402 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMA3 |
| Origin species: | Human |
| Product name: | PSMA3-proteasome (prosome, macropain) subunit, alpha type, 3 Gene |
| Size: | 2ug |
| Accessions: | BC029402 |
| Gene id: | 5684 |
| Gene description: | proteasome (prosome, macropain) subunit, alpha type, 3 |
| Synonyms: | HC8; PSC3; proteasome subunit alpha type-3; macropain subunit C8; multicatalytic endopeptidase complex subunit C8; proteasome (prosome, macropain) subunit, alpha type, 3; proteasome component C8; proteasome subunit C8; testicular secretory protein Li 43; proteasome subunit alpha 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagctcaatcggcactgggtatgacctgtcagcctctacattctctcctgacggaagagtttttcaagttgaatatgctatgaaggctgtggaaaatagtagtacagctattggaatcagatgcaaagatggtgttgtctttggggtagaaaaattagtcctttctaaactttatgaagaaggttccaacaaaagactttttaatgttgatcggcatgttggaatggcagtagcaggtttgttggcagatgctcgttctttagcggacatggcaagagaagaagcttccaacttcagatctaactttggctacaacattccactaaaacatcttgcagacagagtggccatgtatgtgcatgcatatacactctacagtgctgttagaccttttggctgcagtttcatgttagggtcttacagtgtgaatgacggtgcgcaactctacatgattgacccatcaggtgtttcatacggttattggggctgtgccatcggcaaagccagacaagctgcaaagacggaaatagagaagcttcagatgaaagaaatgacctgccgtgatatcgttaaagaagttgcaaaaataatttacatagtacatgacgaagttaaggataaagcttttgaactagaactcagctgggttggtgaattaactaatggaagacatgaaattgttccaaaagatataagagaagaagcagagaaatatgctaaggaatctctgaaggaagaagatgaatcagatgatgataatatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - suppressor of variegation 3-9 homolog 2 (Drosophila) - hepatocyte growth factor (hepapoietin A; scatter factor) - Fc fragment of IgG, low affinity IIa, receptor (CD32) - budding uninhibited by benzimidazoles 3 homolog (yeast) |