Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VPS37A-vacuolar protein sorting 37 homolog A (S. cerevisiae) Gene
PTXBC022363
New product
Data sheet of VPS37A-vacuolar protein sorting 37 homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VPS37A-vacuolar protein sorting 37 homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022363 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS37A |
| Origin species: | Human |
| Product name: | VPS37A-vacuolar protein sorting 37 homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC022363 |
| Gene id: | 137492 |
| Gene description: | vacuolar protein sorting 37 homolog A (S. cerevisiae) |
| Synonyms: | VPS37A, ESCRT-I subunit; ESCRT-I complex subunit VPS37A; PQBP2; SPG53; vacuolar protein sorting-associated protein 37A; hepatocellular carcinoma-related protein 1; polyglutamine binding protein 2; vacuolar protein sorting 37 homolog A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccagatgtccctgatgcatttccagaactctcagaactaagtgtgtcacaactcacagatatgaatgaacaagaggaggtattactagaacagtttctgactttgcctcaactaaaacaaattattaccgacaaagatgacttagtaaaaagtattgaggaactagcaagaaaaaatctccttttggagcccagcttggaagccaaaagacaaactgttttagataagtatgaattacttacacagatgaagtccactttcgaaaagaagatgcaaaggcagcatgaacttagtgagagctgtagtgcaagtgcccttcaggcaagattgaaagtagctgcacatgaagctgaggaagaatctgataatattgcagaagacttcttggagggaaagatggaaatagatgattttctcagtagcttcatggaaaagagaacaatttgccactgtagaagagccaaggaagagaaacttcagcaggcgatagcaatgcacagccaatttcatgctccactatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - killer cell lectin-like receptor subfamily C, member 4 - glycosylphosphatidylinositol specific phospholipase D1 - cytochrome P450, family 2, subfamily C, polypeptide 9 - proteasome (prosome, macropain) subunit, alpha type, 4 |