Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KLRC4-killer cell lectin-like receptor subfamily C, member 4 Gene
PTXBC017784
New product
Data sheet of KLRC4-killer cell lectin-like receptor subfamily C, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KLRC4-killer cell lectin-like receptor subfamily C, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017784 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KLRC4 |
| Origin species: | Human |
| Product name: | KLRC4-killer cell lectin-like receptor subfamily C, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC017784 |
| Gene id: | 8302 |
| Gene description: | killer cell lectin-like receptor subfamily C, member 4 |
| Synonyms: | NKG2-F; NKG2F; NKG2-F type II integral membrane protein; NK cell receptor F; NKG2-F-activating NK receptor; killer cell lectin-like receptor subfamily C, member 4; natual killer cell group 2-F; killer cell lectin like receptor C4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaataaacaaagaggaacctactcagaagtgagtctggcccaggacccaaagaggcagcaaaggaaacttaagggcaataaaatctccatttcaggaaccaaacaggaaatattccaagtagaattaaaccttcaaaatgcttcttcggatcatcaagggaatgacaagacatatcactgcaaaggtttactgccacctccagagaagctcactgctgaggtcctaggaatcatttgcattgtcctgatggccactgtgttaaaaacaatagttcttattccttgtattggagtactggagcagaacaatttttccctgaatagaagaatgcagaaagcacgtcattgtggccattgtcctgaggagtggattacatattccaacagttgttattacattggtaaggaaagaagaacttgggaagaaagagtttgctggcctgtgcttcgaagaactctgatctgctttctatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycosylphosphatidylinositol specific phospholipase D1 - cytochrome P450, family 2, subfamily C, polypeptide 9 - proteasome (prosome, macropain) subunit, alpha type, 4 - proteasome (prosome, macropain) subunit, alpha type, 3 |