Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DLEU1-deleted in lymphocytic leukemia 1 (non-protein coding) Gene
PTXBC020692
New product
Data sheet of DLEU1-deleted in lymphocytic leukemia 1 (non-protein coding) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DLEU1-deleted in lymphocytic leukemia 1 (non-protein coding) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020692 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DLEU1 |
| Origin species: | Human |
| Product name: | DLEU1-deleted in lymphocytic leukemia 1 (non-protein coding) Gene |
| Size: | 2ug |
| Accessions: | BC020692 |
| Gene id: | 10301 |
| Gene description: | deleted in lymphocytic leukemia 1 (non-protein coding) |
| Synonyms: | BCMS; DLB1; DLEU2; LEU1; LEU2; LINC00021; NCRNA00021; XTP6; deleted in lymphocytic leukemia 1 (non-protein coding) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagaccttgtatatggatacacgtgcatttaaaaccgccctgccggcttgtagagcttttgccgttctccagcgctttacaggggttatcgcacttaagcctcggaacaactttaccagtgattctaccagaaaggaatgaagaacagaaccttcaggaattgagtcacaatgcagacaaatatcaaatgggagattgttgcaaggaagagattgatgatagtattttctactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 - vacuolar protein sorting 37 homolog A (S. cerevisiae) - killer cell lectin-like receptor subfamily C, member 4 - glycosylphosphatidylinositol specific phospholipase D1 |