PSMA2-proteasome (prosome, macropain) subunit, alpha type, 2 Gene View larger

PSMA2-proteasome (prosome, macropain) subunit, alpha type, 2 Gene

PTXBC047697

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMA2-proteasome (prosome, macropain) subunit, alpha type, 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMA2-proteasome (prosome, macropain) subunit, alpha type, 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC047697
Product type: DNA & cDNA
Ncbi symbol: PSMA2
Origin species: Human
Product name: PSMA2-proteasome (prosome, macropain) subunit, alpha type, 2 Gene
Size: 2ug
Accessions: BC047697
Gene id: 5683
Gene description: proteasome (prosome, macropain) subunit, alpha type, 2
Synonyms: HC3; PMSA2; PSC2; proteasome subunit alpha type-2; macropain subunit C3; multicatalytic endopeptidase complex subunit C3; proteasome (prosome, macropain) subunit, alpha type, 2; proteasome component C3; proteasome subunit HC3; proteasome subunit alpha 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagcgcgggtacagcttttcgctgactacattcagcccgtctggtaaacttgtccagattgaatatgctttggctgctgtagctggaggagccccgtccgtgggaattaaagctgcaaatggtgtggtattagcaactgagaaaaaacagaaatccattctgtatgatgagcgaagtgtacacaaagtagaaccaattaccaagcatataggtttggtgtacagtggcatgggccccgattacagagtgcttgtgcacagagctcgaaaactagctcaacaatactatcttgtgtaccaagaacccattcctacagctcagctggtacagagagtagcttctgtgatgcaagaatatactcagtcaggtggtgttcgtccatttggagtttctttacttatttgtggttggaatgagggacgaccatatttatttcagtcagatccatctggagcttactttgcctggaaagctacagcaatgggaaagaactatgtgaatgggaagactttccttgagaaaagatataatgaagatctggaacttgaagatgccattcatacagccatcttaaccctaaaggaaagctttgaagggcaaatgacagaggataacatagaagttggaatctgcaatgaagctggatttaggaggcttactccaactgaagttaaggattacttggctgccatagcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tRNA splicing endonuclease 54 homolog (S. cerevisiae)
- vacuolar protein sorting 37 homolog D (S. cerevisiae)
- hepatocyte growth factor (hepapoietin A; scatter factor)
- pyridoxal-dependent decarboxylase domain containing 2

Buy PSMA2-proteasome (prosome, macropain) subunit, alpha type, 2 Gene now

Add to cart