Login to display prices
Login to display prices
CXCR3-chemokine (C-X-C motif) receptor 3 Gene View larger

CXCR3-chemokine (C-X-C motif) receptor 3 Gene

PTXBC034403

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCR3-chemokine (C-X-C motif) receptor 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CXCR3-chemokine (C-X-C motif) receptor 3 Gene

Proteogenix catalog: PTXBC034403
Ncbi symbol: CXCR3
Product name: CXCR3-chemokine (C-X-C motif) receptor 3 Gene
Size: 2ug
Accessions: BC034403
Gene id: 2833
Gene description: chemokine (C-X-C motif) receptor 3
Synonyms: CD182; CD183; CKR-L2; CMKAR3; GPR9; IP10-R; Mig-R; MigR; C-X-C chemokine receptor type 3; G protein-coupled receptor 9; IP-10 receptor; Mig receptor; chemokine (C-X-C motif) receptor 3; chemokine receptor 3; interferon-inducible protein 10 receptor; C-X-C motif chemokine receptor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtccttgaggtgagtgaccaccaagtgctaaatgacgccgaggttgccgccctcctggagaacttcagctcttcctatgactatggagaaaacgagagtgactcgtgctgtacctccccgccctgcccacaggacttcagcctgaacttcgaccgggccttcctgccagccctctacagcctcctctttctgctggggctgctgggcaacggcgcggtggcagccgtgctgctgagccggcggacagccctgagcagcaccgacaccttcctgctccacctagctgtagcagacacgctgctggtgctgacactgccgctctgggcagtggacgctgccgtccagtgggtctttggctctggcctctgcaaagtggcaggtgccctcttcaacatcaacttctacgcaggagccctcctgctggcctgcatcagctttgaccgctacctgaacatagttcatgccacccagctctaccgccgggggcccccggcccgcgtgaccctcacctgcctggctgtctgggggctctgcctgcttttcgccctcccagacttcatcttcctgtcggcccaccacgacgagcgcctcaacgccacccactgccaatacaacttcccacaggtgggccgcacggctctgcgggtgctgcagctggtggctggctttctgctgcccctgctggtcatggcctactgctatgcccacatcctggccgtgctgctggtttccaggggccagcggcgcctgcgggccatgcggctggtggtggtggtcgtggtggcctttgccctctgctggaccccctatcacctggtggtgctggtggacatcctcatggacctgggcgctttggcccgcaactgtggccgagaaagcagggtagacgtggccaagtcggtcacctcaggcctgggctacatgcactgctgcctcaacccgctgctctatgcctttgtaggggtcaagttccgggagcggatgtggatgctgctcttgcgcctgggctgccccaaccagagagggctccagaggcagccatcgtcttcccgccgggattcatcctggtctgagacctcagaggcctcctactcgggcttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: