RBMX-RNA binding motif protein, X-linked Gene View larger

RBMX-RNA binding motif protein, X-linked Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBMX-RNA binding motif protein, X-linked Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBMX-RNA binding motif protein, X-linked Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006550
Product type: DNA & cDNA
Ncbi symbol: RBMX
Origin species: Human
Product name: RBMX-RNA binding motif protein, X-linked Gene
Size: 2ug
Accessions: BC006550
Gene id: 27316
Gene description: RNA binding motif protein, X-linked
Synonyms: HNRNPG; HNRPG; MRXS11; RBMXP1; RBMXRT; RNMX; hnRNP-G; RNA-binding motif protein, X chromosome; glycoprotein p43; heterogeneous nuclear ribonucleoprotein G; hnRNP G; RNA binding motif protein, X-linked
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttgaagcagatcgcccaggaaagctcttcattggtgggcttaatacggaaacaaatgagaaagctcttgaagcagtatttggcaaatatggacgaatagtggaagtactcttgatgaaagaccgtgaaaccaacaaatcaagaggatttgcttttgtcacctttgaaagcccagcagacgctaaggatgcagccagagacatgaatggaaagtcattagatggaaaagccatcaaggtggaacaagccaccaaaccatcatttgaaagtggtagacgtggaccgcctccacctccaagaagtagaggccctccaagaggtcttagaggtggaagaggaggaagtggaggaaccaggggacctccctcacggggaggacacatggatgacggtggatattccatgaattttaacatgagttcttccaggggaccactcccagtaaaaagaggaccaccaccaagaagtgggggtcctcctcctaagagatctgcaccttcaggaccagttcgcagtagcagtggaatgggaggaagagctcctgtatcacgtggaagagatagttatggaggtccacctcgaagggaaccgctgccctctcgtagagatgtttatttgtccccaagagatgatgggtattctactaaagacagctattcaagcagagattacccaagttctcgtgatactagagattatgcaccaccaccacgagattatacttaccgtgattatggtcattccagttcacgtgatgactatccatcaagaggatatagcgatagagatggatatggtcgtgatcgtgactattcagatcatccaagtggaggttcctacagagattcatatgagagttatggtaactcacgtagtgctccacctacacgagggcccccgccatcttatggtggaagcagtcgctatgatgattacagcagctcacgtgacggatatggtggaagtcgagacagttactcaagcagccgaagtgatctctactcaagtggtcgtgatcgggttggcagacaagaaagagggcttcccccttctatggaaagggggtaccctcctccacgtgattcctacagcagttcaagccgcggagcaccaagaggtggtggccgtggaggaagccgatctgatagagggggaggcagaagcagatactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Smad nuclear interacting protein 1
- sphingosine-1-phosphate receptor 5
- indoleamine-pyrrole 2,3 dioxygenase
- WD repeat and SOCS box-containing 2

Buy RBMX-RNA binding motif protein, X-linked Gene now

Add to cart