WSB2-WD repeat and SOCS box-containing 2 Gene View larger

WSB2-WD repeat and SOCS box-containing 2 Gene

PTXBC015887

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WSB2-WD repeat and SOCS box-containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WSB2-WD repeat and SOCS box-containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015887
Product type: DNA & cDNA
Ncbi symbol: WSB2
Origin species: Human
Product name: WSB2-WD repeat and SOCS box-containing 2 Gene
Size: 2ug
Accessions: BC015887
Gene id: 55884
Gene description: WD repeat and SOCS box-containing 2
Synonyms: SBA2; WD repeat and SOCS box-containing protein 2; CS box-containing WD protein; WSB-2; WD repeat and SOCS box containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccggagaggaaccgctgctgctggccgaactcaagcccgggcgcccccaccagtttgattggaagtccagctgtgaaacctggagcgtcgccttctccccagatggctcctggtttgcttggtctcaaggacactgcatcgtcaaactgatcccctggccgttggaggagcagttcatccctaaagggtttgaagccaaaagccgaagtagcaaaaatgagacgaaagggcggggcagcccaaaagagaagacgctggactgtggtcagattgtctgggggctggccttcagcccgtggccttccccacccagcaggaagctctgggcacgccaccacccccaagtgcccgatgtctcttgcctggttcttgctacgggactcaacgatgggcagatcaagatctgggaggtgcagacagggctcctgcttttgaatctttccggccaccaagatgtcgtgagagatctgagcttcacacccagtggcagtttgattttggtctccgcgtcacgggataagactcttcgcatctgggacctgaataaacacggtaaacagattcaagtgttatcgggccacctgcagtgggtttactgctgttccatctccccagactgcagcatgctgtgctctgcagctggagagaagtcggtctttctatggagcatgaggtcctacacgttaattcggaagctagagggccatcaaagcagtgttgtctcttgtgacttctcccccgactctgccctgcttgtcacggcttcttacgataccaatgtgattatgtgggacccctacaccggcgaaaggctgaggtcactccaccacacccaggttgaccccgccatggatgacagtgacgtccacattagctcactgagatctgtgtgcttctctccagaaggcttgtaccttgccacggtggcagatgacagactcctcaggatctgggccctggaactgaaaactcccattgcatttgctcctatgaccaatgggctttgctgcacattttttccacatggtggagtcattgccacagggacaagagatggccacgtccagttctggacagctcctagggtcctgtcctcactgaagcacttatgccggaaagcccttcgaagtttcctaacaacttaccaagtcctagcactgccaatccccaagaaaatgaaagagttcctcacatacaggactttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - STE20-related kinase adaptor beta
- galactose-3-O-sulfotransferase 1
- mitogen-activated protein kinase 9
- leucine rich repeat containing 42

Buy WSB2-WD repeat and SOCS box-containing 2 Gene now

Add to cart