S1PR5-sphingosine-1-phosphate receptor 5 Gene View larger

S1PR5-sphingosine-1-phosphate receptor 5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S1PR5-sphingosine-1-phosphate receptor 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about S1PR5-sphingosine-1-phosphate receptor 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034703
Product type: DNA & cDNA
Ncbi symbol: S1PR5
Origin species: Human
Product name: S1PR5-sphingosine-1-phosphate receptor 5 Gene
Size: 2ug
Accessions: BC034703
Gene id: 53637
Gene description: sphingosine-1-phosphate receptor 5
Synonyms: EDG8; Edg-8; S1P5; SPPR-1; SPPR-2; sphingosine 1-phosphate receptor 5; S1P receptor 5; S1P receptor Edg-8; endothelial differentiation G-protein-coupled receptor 8; endothelial differentiation, sphingolipid G-protein-coupled receptor, 8; sphingosine 1-phosphate receptor EDG8; sphingosine 1-phosphate receptor Edg-8; sphingosine-1-phosphate receptor 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtcggggctgctgcggccggcgccggtgagcgaggtcatcgtcctgcattacaactacaccggcaagctccgcggtgcgcgctaccagccgggtgccggcctgcgcgccgacgccgtggtgtgcctggcggtgtgcgccttcatcgtgctagagaatctagccgtgttgttggtgctcggacgccacccgcgcttccacgctcccatgttcctgctcctgggcagcctcacgttgtcggatctgctggcaggcgccgcctacgccgccaacatcctactgtcggggccgctcacgctgaaactgtcccccgcgctctggttcgcacgggagggaggcgtcttcgtggcactcactgcgtccgtgctgagcctcctggccatcgcgctggagcgcagcctcaccatggcgcgcagggggcccgcgcccgtctccagtcgggggcgcacgctggcgatggcagccgcggcctggggcgtgtcgctgctcctcgggctcctgccagcgctgggctggaattgcctgggtcgcctggacgcttgctccactgtcttgccgctctacgccaaggcctacgtgctcttctgcgtgctcgccttcgtgggcatcctggccgcgatctgtgcactctacgcgcgcatctactgccaggtacgcgccaacgcgcggcgcctgccggcacggcccgggactgcggggaccacctcgacccgggcgcgtcgcaagccgcgctcgctggccttgctgcgcacgctcagcgtggtgctcctggcctttgtggcatgttggggccccctcttcctgctgctgttgctcgacgtggcgtgcccggcgcgcacctgtcctgtactcctgcaggccgatcccttcctgggactggccatggccaactcacttctgaaccccatcatctacacgctcaccaaccgcgacctgcgccacgcgctcctgcgcctggtctgctgcggacgccactcctgcggcagagacccgagtggctcccagcagtcggcgagcgcggctgaggcttccgggggcctgcgccgctgcctgcccccgggccttgatgggagcttcagcggctcggagcgctcatcgccccagcgcgacgggctggacaccagcggctccacaggcagccccggtgcacccacagccgcccggactctggtatcagaaccggctgcagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - indoleamine-pyrrole 2,3 dioxygenase
- WD repeat and SOCS box-containing 2
- STE20-related kinase adaptor beta
- galactose-3-O-sulfotransferase 1

Buy S1PR5-sphingosine-1-phosphate receptor 5 Gene now

Add to cart