Login to display prices
Login to display prices
INDO-indoleamine-pyrrole 2,3 dioxygenase Gene View larger

INDO-indoleamine-pyrrole 2,3 dioxygenase Gene

PTXBC027882

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of INDO-indoleamine-pyrrole 2,3 dioxygenase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about INDO-indoleamine-pyrrole 2,3 dioxygenase Gene

Proteogenix catalog: PTXBC027882
Ncbi symbol: INDO
Product name: INDO-indoleamine-pyrrole 2,3 dioxygenase Gene
Size: 2ug
Accessions: BC027882
Gene id: 3620
Gene description: indoleamine-pyrrole 2,3 dioxygenase
Synonyms: INDO; IDO; IDO-1; indoleamine 2,3-dioxygenase 1; indolamine 2,3 dioxygenase; indole 2,3-dioxygenase; indoleamine-pyrrole 2,3-dioxygenase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacacgctatggaaaactcctggacaatcagtaaagagtaccatattgatgaagaagtgggctttgctctgccaaatccacaggaaaatctacctgatttttataatgactggatgttcattgctaaacatctgcctgatctcatagagtctggccagcttcgagaaagagttgagaagttaaacatgctcagcattgatcatctcacagaccacaagtcacagcgccttgcacgtctagttctgggatgcatcaccatggcatatgtgtggggcaaaggtcatggagatgtccgtaaggtcttgccaagaaatattgctgttccttactgccaactctccaagaaactggaactgcctcctattttggtttatgcagactgtgtcttggcaaactggaagaaaaaggatcctaataagcccctgacttatgagaacatggacgttttgttctcatttcgtgatggagactgcagtaaaggattcttcctggtctctctattggtggaaatagcagctgcttctgcaatcaaagtaattcctactgtattcaaggcaatgcaaatgcaagaacgggacactttgctaaaggcgctgttggaaatagcttcttgcttggagaaagcccttcaagtgtttcaccaaatccacgatcatgtgaacccaaaagcatttttcagtgttcttcgcatatatttgtctggctggaaaggcaacccccagctatcagacggtctggtgtatgaagggttctgggaagacccaaaggagtttgcagggggcagtgcaggccaaagcagcgtctttcagtgctttgacgtcctgctgggcatccagcagactgctggtggaggacatgctgctcagttcctccaggacatgagaagatatatgccaccagctcacaggaacttcctgtgctcattagagtcaaatccctcagtccgtgagtttgtcctttcaaaaggtgatgctggcctgcgggaagcttatgacgcctgtgtgaaagctctggtctccctgaggagctaccatctgcaaatcgtgactaagtacatcctgattcctgcaagccagcagccaaaggagaataagacctctgaagacccttcaaaactggaagccaaaggaactggaggcactgatttaatgaatttcctgaagactgtaagaagtacaactgagaaatcccttttgaaggaaggttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: